…e innen Br. Johannes über die gestrige Brother Johannes spoke about yesterday's events. Broer Johannes het oor gister se gebeure gepraat. GN1765_1_584 u. heutige Loos. redete, wurden 3 leib. und heutige Losung redete, wurden 3 leib. and today's motto was spoken, 3 bodies were bor…

…n which almost no pottery from the 2nd the small size of this latter fragment prevents and early 1st millennium BCE was identified. to match both shapes with certainty, even if the dating of the well fill in the 1st century Nine jar necks were found in SU 2562, most could fit wel…

…ainst potentially discriminatory risk pooling practices. We note that nothing prevents a State from requiring broader risk pooling with respect to student health insurance coverage than provided for in this final rule (for example, requiring each student health insurance issuer t…

…ainst potentially discriminatory risk pooling practices. We note that nothing prevents a State from requiring broader risk pooling with respect to student health insurance coverage than provided for in this final rule (for example, requiring each student health insurance issuer t…

…ainst potentially discriminatory risk pooling practices. We note that nothing prevents a State from requiring broader risk pooling with respect to student health insurance coverage than provided for in this final rule (for example, requiring each student health insurance issuer t…

…ainst potentially discriminatory risk pooling practices. We note that nothing prevents a State from requiring broader risk pooling with respect to student health insurance coverage than provided for in this final rule (for example, requiring each student health insurance issuer t…

Abstract Events encoded in separate sensory modalities, such as audition and vision, can seem to be synchronous across a relatively broad range of physical timing differences. This may suggest that the precision of audio-visual timing judgments is inherently poor. Here we show th…

…uthors Metrics Comments Media Coverage Reader Comments Figures Figures Abstract Events encoded in separate sensory modalities, such as audition and vision, can seem to be synchronous across a relatively broad range of physical timing differences. This may suggest that the precisi…

…CACAAGAACTG 5′-half 8031 37029.01 1004.96 na Summary d trnaMT_SerGCT_MT_+_12207_12265@1.20.20 ATTGGTCGTGGTTGTAGTCCGTGCGAGAATACCA 3′-tRF 7129 32870.11 892.08 na Summary 3 trnalookalike8_GluTTC_5_−_93905172_93905240@39.72.34, trnaMT_GluTTC_MT_−_14674_14742@39.72.34 GAGAAAGCTCACAAGA…

… with 120 trials began. The order of the trials was randomized. The sequence of events in each trial is shown in Fig. 1. The control group performed the same behavioral task however experienced no stimulation and was unconnected to the tDCS apparatus. 2.3. Simultaneity judgment t…