Tropical Biomedicine 31(4): 709–720 (2014) A real-time loop-mediated isothermal amplification assay for rapid detection of Shigella species Liew, P.S.1,2, Teh, C.S.J.2,3, Lau, Y.L.4 and Thong, K.L.1,2* 1Instituteof Biological Sciences, Faculty of Science, University of Malaya, 50603 Kuala Lumpur, Malaysia 2Laboratory of Biomedical Science and Molecular Microbiology, Institute of Graduate Studies, University of Malaya 3Department of Medical Microbiology, Faculty of Medicine, University of Malaya 4Department of Parasitology, Faculty of Medicine, University of Malaya *Corresponding author email:
[email protected]Received 21 January 2014; received in revised form 16 April 2014; accepted 25 April 2014 Abstract. Shigellosis is a foodborne illness caused by the genus Shigella and is an important global health issue. The development of effective techniques for rapid detection of this pathogen is essential for breaking the chain of transmission. Therefore, we have developed a novel loop-mediated isothermal amplification (LAMP) assay targeting the invasion plasmid antigen H (ipaH) gene to rapidly detect Shigella species. This assay could be performed in 90 min at an optimal temperature of 64ºC, with endpoint results visualized directly. Notably, the method was found to be more sensitive than conventional PCR. Indeed, the detection limit for the LAMP assay on pure bacterial cultures was 5.9 x 105 CFU/ml, while PCR displayed a limit of 5.9 x 107 CFU/ml. In spiked lettuce samples, the sensitivity of the LAMP assay was 3.6 x 104 CFU/g, whereas PCR was 3.6 x 10 5 CFU/g. Overall, the assay accurately identified 32 Shigella spp. with one enteroinvasive Escherichia coli displaying positive reaction while the remaining 32 non-Shigella strains tested were negative. INTRODUCTION estimated that 125 million cases of shigellosis occur annually in Asia, resulting The genus Shigella belongs to the family in 14,000 deaths (Bardhan et al., 2010). Also, Enterobacteriaceae, which is characterized shigellosis is more common in children less by Gram-negative, rod-shaped, non-motile, than five years old (von Seidlein et al., 2006). non-spore forming facultative anaerobes. Shigella is transmitted through consumption There are four species of Shigella: Shigella of contaminated foods (e.g., potato salad, raw flexneri, Shigella sonnei, Shigella boydii, vegetables, meat, and milk) and improper and Shigella dysenteriae. Shigella is widely food handling. acknowledged as one of the most important Several assays for detecting Shigella foodborne pathogens involved in shigellosis have been reported. The direct culture outbreaks. Indeed, S. dysenteriae is the method is time consuming and involves primary pathogen causing bacillary multiple steps, such as pre-enrichment and dysentery (Trofa et al., 1999). Symptoms of enrichment, followed by plating on selective shigellosis include a short period of watery and diagnostic agars (FDA, 2001). In order to diarrhea, abdominal pains, and malaise, overcome issues related to low specificity which can be followed by permanent and sensitivity, PCR-based methods were emission of stools with blood and mucus developed (Li et al., 2004; Thong et al., (World Health Organization, 2009). 2005). Although PCR assays can allow rapid Shigella is more common in developing detection of food-borne pathogens (within countries, particularly in Asia. In fact, it is 24 h), they display limitations, including a 709 requirement for trained personnel, high risk DNA extraction by boiling method of contamination, low detection limit, and A loopful of bacterial colonies was suspended need for expensive equipment/reagents in 100 µl of deionized water. The bacterial (Wang et al., 2012). suspensions were heated at 99ºC for 5 min Notomi et al. (2000) developed a novel and immediately chilled on ice for 10 min. technique termed loop-mediated isothermal Finally, the crude lysates were centrifuged amplification (LAMP), which represents a at 13,400 rpm for 3 min and the supernatant simple, rapid, specific, and cost-effective was used as DNA templates for PCR and nucleic acid amplification method. The assay LAMP assays. is performed under isothermal conditions (constant temperature) and utilizes a strand Polymerase Chain Reaction (PCR) displacement reaction, omitting the need for The primers used for PCR were Shig1 and fluctuating temperatures to denature and re- Shig2 (targeted ipaH gene) previously anneal DNA strands. Moreover, the LAMP reported by Thong et al. (2005) (Table 1). assay displays very high specificity due to The PCR reaction was performed in 25 µl the use of four primers, which recognize six volumes containing 1X PCR buffer distinct regions of the target gene (Notomi et (Promega, USA), 1 mM MgCl2, each of the al., 2000; Zhang et al., 2011). Furthermore, deoxynucleoside triphosphates (dNTPs) at the whole process from sample collection to 0.02 mM, 0.4 µM of each Shig1 and Shig2 detection requires only 90 minutes, and primers, 1U of Taq DNA polymerase endpoint results can be achieved based on (Promega, USA) and 5 µl DNA template simple fluorescence and turbidity (~50 ng/µL). A negative control (using water visualization. as template) was included. Here, we report the development of a DNA amplification was performed in an rapid, simple, and novel LAMP assay for the Eppendorf Mastercycler EP Gradient detection of four Shigella species. Moreover, Thermal Cycler. The thermal profile for PCR we compared the specificity and sensitivity was 95ºC at 5 min for initial denaturation, of our LAMP assay to conventional PCR- followed by 30 cycles of 95ºC for 50 s, 55ºC based detection of Shigella using pure for 1.5 min and 72ºC for 2 min and a final cultures and spiked lettuce samples. extension cycle at 72ºC for 7 min. The PCR products (5 µl each) were analyzed on a 1.5% agarose gel by electrophoresis. A MATERIALS AND METHODS 100 bp ladder was used as a molecular size marker. The gel was then stained Bacterial strains and visualized by using Gel Doc XR A total of 65 bacterial strains were used, documentation system (Bio-Rad Labora- including 13 Shigella sonnei, 9 Shigella tories, Inc., CA, USA). flexneri, 1 Shigella boydii, 9 Shigella dysenteriae, and 33 non-Shigella spp. as Primer design for LAMP assay negative controls. All the bacteria were The FIP, BIP, F3, and B3 primers were previously obtained from clinical samples, designed using the LAMP Primer Explorer food or zoonotic sources. The bacteria from V4 software (http://primerexplorer.jp/ glycerol stocks were cultured on Luria- elamp4.0.0/index.html) to target 6 distinct Bertani (LB) agar plate and allowed to grow regions of ipaH gene based the published DNA overnight to obtain single colonies. Then, a sequence of the Shigella flexneri 2a str. single colony was cultured on selective 2457T (GenBank: NC004741) (Table 1). The Xylose lysine deoxycholate (XLD) agar to specificity of the primers for the selected check for purity of Shigella spp. regions of ipaH gene was confirmed 710 Table 1. List of primer sequences of the PCR and LAMP Methods Primers Length Sequences (5’J3’) Source PCR Shig 1 20 TGGAAAAACTCAGTGCCTCT Thong et al., 2005 Shig 2 20 CCAGTCCGTAAATTCATTCT LAMP F3 19 GGAGAATTCCCGGGCATTC This study B3 20 TCCGGAGATTGTTCCATGTG FIP (F1c – F2) 40 CGACCTGTTCACGGAATCCGG- CGTTCCTTGACCGCCTTTC BIP (B1c – B2) 38 CTGCGGAGCTTCGACAGCAG- CGGTCCTCACAGCTCTCA using BLAST of the National Center for turbidity exceeds the threshold (Tt) value Biotechnology Information (NCBI) server which is 0.1 within the time of amplification (http://blast.ncbi.nlm.nih.gov/Blast.cgi). The (Mori et al., 2004). The end-point detection primers were synthesized commercially by of positive results could also be determined Bioneer (Bioneer, Inc., CA, USA). by direct visualization of the turbidity of the mixtures. After a brief centrifugation, LAMP assay presence of accumulated white pellet The LAMP reaction was conducted as indicates positive results (Mori et al., 2001). described by Notomi et al. (2000) using Another method of visualization of end Loopamp DNA amplification kit (Eiken product is the addition of SYBR green dye. Chemical Co., Ltd., Tokyo, Japan). Briefly, the An aliquot of 1 µl of 10-fold diluted SYBR LAMP reaction was carried out in a final Green I (Invitrogen, CA, USA) was added to volume of 25 µl containing 12.5 µl of 2X 25 µl of amplicons of LAMP assay. A positive reaction mix provided in the kit, 40 pmol of or negative result was determined through each primer FIP and BIP, 5 pmol of each both visual observation of the color change primer F3 and B3, 8U of Bst DNA polymerase of the solution under visible light and a and 2.5 µl of DNA template. The same reaction fluorescence assay under ultraviolet (UV). mixture without template DNA (replaced For further confirmation, 5 µl of LAMP by deionized water) was used as a negative products were subjected to horizontal control. electrophoresis in 1.5% agarose gel. A 100 The reactions were carried out in the LA- bp ladder was used as a molecular size 500 Loopamp real-time turbidimeter (Eiken marker. The gel was then stained with Gel Chemical Co., Ltd., Tokyo, Japan). This device Red for 30 min and photographed using Gel is specially designed for real-time reporting Doc XR documentation system (Bio-Rad of loop-mediated isothermal amplification Laboratories, Inc., CA, USA). reaction whereby it detects and records the turbidity values every 6 s. The reactions were Specificity test of LAMP and PCR conducted at 64ºC for 90 min, followed by amplification enzyme inactivation at 80ºC for 2 min. The To determine the specificity of the primers, experiment was performed twice to ensure LAMP assay was applied on a total of 32 reproducibility. Shigella spp. and 33 non-Shigella strains. The non-Shigella strains included Visualisation of LAMP product Escherichia coli, Salmonella spp., Vibrio By using the real-time turbidimeter, positive spp., Yersinia spp., Klebsiella pnuemoniae amplification was indicated when the and Acinetobacter baumannii. 711 Sensitivity test of LAMP and PCR were generated by plotting time threshold, amplification on pure bacterial cultures Tt values against log CFU/ml for the real- A S. sonnei strain (TH 2/10) was used to time turbidimeter platform and the linear determine the sensitivity of LAMP and PCR regression was calculated using the Microsoft detections. A single colony of bacteria was Excel Software. The detection limits (number inoculated in 1 ml of Luria-Bertani (LB) broth. of CFU/ml in pure culture or in spiked lettuce) The culture was allowed to grow for 3-5 hours were presented as the lowest numbers of the at 37ºC until the OD600 was approximately 1. cells that could be detected by the assays. The broth culture was serially diluted 10-fold Quantitative capabilities of the assays were and each dilution was used as DNA template derived based on the correlation coefficient for the PCR and LAMP amplification as (R2) values from the standard curves. described in Section 2.3 and Section 2.5. The same reaction mixture without template DNA (replaced by sterile water) was used as a RESULTS negative control. The amplicons were analyzed by gel electrophoresis in 1.5% Optimization of the LAMP condition for agarose gel. Each assay was repeated at least detection of Shigella spp. twice to ensure reproducibility. The parameters tested were the temperature and time taken to amplify DNA. The Sensitivity test of LAMP and PCR temperatures tested were 60ºC, 64ºC and amplification with spiked food 65ºC. No amplification of DNA was observed Lettuce was chosen as the food matrix to at 60ºC while amplification was observed at evaluate the sensitivity of LAMP assay in this 64ºC and 65ºC. Both temperatures showed study. This is because lettuce is commonly almost the same amplification time, but a eaten raw or as part of the ready-to-eat food higher turbidity value was obtained at 64ºC ingredient. Preparation of bacterial culture (data not shown). Hence, the temperature at was performed as described in Section 2.8. 64ºC was selected for subsequent analysis. Briefly, a 10 g sample of lettuce was spiked Amplifications occurred between 49.5 to 85 with 1 ml of bacterial culture and left at room min for the 65 strains tested (data not shown). temperature for around 30 min. The food was Hence, the amplification time was set within homogenized with 90 ml of Gram-negative 90 min. (GN) broth using a stomacher to produce 1:10 lettuce-GN homogenate. The homogenate Specificity of LAMP and PCR was then analyzed immediately. Briefly, the amplification homogenate was subjected to 10-fold serial Positive reactions were detected in all 32 dilutions. An aliquot of 100 µl of each dilution Shigella strains. In the real-time turbidimeter was spread onto Salmonella-Shigella agar in platform, the time threshold, Tt values fell duplicates for colony count while another 100 between 49.5 to 85 min with the average of µl of the dilutions were centrifuged at 13,400 67.2 min for DNA prepared from cell densities rpm for 3 min for crude DNA extraction for of 5.9 x 106 to 5.9 x 109 CFU/ml. Among the 10 later used in LAMP and PCR assay. Besides E. coli strains tested, only enteroinvasive that, enrichment was performed by E. coli (EIEC) gave positive reaction. No Tt incubating the Shigella-spiked produce value was observed for the other 32 non- homogenate overnight at 37ºC. After that, the Shigella strains. These results obtained by homogenate was processed similarly as using LAMP assay were comparable with described above for colony count and also PCR (Table 2). All the tubes that showed the crude DNA preparation for PCR and positive reactions for Shigella spp. were LAMP assay. turbid and white pellets were formed after a brief centrifugation (data not shown). The Data analysis LAMP products were also subjected to Standard curves for sensitivity of LAMP assay agarose gel electrophoresis (Fig. 2) and with pure bacterial culture and spiked lettuce ladder-like DNA bands were observed. After 712 Figure 1. Locations and nucleotide sequence of the ipaH gene of Shigella flexneri 2a str. 2457T used for designing the PCR and LAMP primers Table 2. Bacterial strains used and results for PCR and LAMP assay for detection of Shigella No. of positive for Bacterial species No. tested PCR LAMP Shigella Shigella sonnei 13 13 13 Shigella flexneri 9 9 9 Shigella boydii 1 1 1 Shigella dysenteriae 9 9 9 Non-Shigella Escherichia coli 10 1 1 Salmonella Enteritidis 2 0 0 Salmonella Albany 1 0 0 Salmonella Typhimurium 1 0 0 Salmonella Typhi 2 0 0 Vibrio spp. 2 0 0 Vibrio cholerae 2 0 0 Vibrio parahaemolyticus 2 0 0 Acinetobacter baumannii 2 0 0 Klebsiella pneumoniae 7 0 0 Yersinia enterocolitica 2 0 0 713 Figure 2. Specificity test of the LAMP reaction for detection of ipaH gene of Shigella (A) using SYBR Green I (B) and through gel electrophoresis. Lane M: 100-bp DNA ladder as size markers; Lane 1: negative control (no DNA template); Lane 2-6: Shigella sonnei (TH 7/08), Shigella sonnei (TC 25/98), Shigella dysenteriae (TH 23/97), Shigella flexneri (TH 1/01), and Shigella boydii (TH 26/98) respectively; Lane 7: Salmonella Typhimurium (STM 342/ 04); Lane 8: Acinetobacter baumannii (AC 090203); Lane 9: Vibrio cholerae (VC 1338); Lane 10: Escherichia coli (EC 15). the addition of SYBR Green I, all the tubes in a real-time turbidimeter was 5.9 x 105 CFU/ with positive reactions demonstrated a color ml. In contrast, the PCR assay on pure culture change from orange to green-yellowish had a detection limit of 5.9 x 107 CFU/ml whereas for tubes with non-Shigella spp. the (Fig. 4). Therefore, LAMP assay was 100-fold original orange colour of SYBR Green I was more sensitive than PCR assay. A positive retained (Fig. 2). amplification by LAMP assay was shown by the increase of turbidity while the PCR assay Sensitivity and quantitative capabilities was indicated by the 422 bp band (Fig. 4). of LAMP and PCR amplification with A standard curve of the tests on 10-fold pure bacterial cultures serially diluted pure culture of S. sonnei The sensitivity of the ipaH-based LAMP strain TH 2/10 was generated by the real-time assay and PCR assay were tested using 10- turbidimeter with the cell numbers ranging fold serial dilutions of viable culture of from 5.9 x 105 to 5.9 x 108 CFU/ ml. According Shigella sonnei in 0.85% saline solution. A to the standard curve, the correlation representative turbidity graph from the real- coefficient (R2) value for LAMP assay was time turbidimeter platform is shown in Fig. 0.908. The high R2 value indicates good linear 3A. For pure culture templates ranging from relationships between Shigella cell numbers 5.9 x 105 to 5.9 x 108 CFU/ml, there were (log CFU/ml) and the amplification signals amplifications with the Tt values fell between (Tt values), whereby the Tt value decreases 60 to 110 min. No amplification was obtained as the cell numbers of Shigella increases for DNA from cell densities of 5.9 x 102 to 5.9 (Fig. 3). PCR, on the other hand, is not x 104 CFU/ml. Therefore, the detection limit quantitative. of the LAMP assay on pure culture analysed 714 (A) (B) Figure 3. Sensitivity test for detection of ipaH gene of Shigella from pure cultures using real-time turbidimeter. (A) The curves from left to right indicate the decreasing concentration of CFU from bacterial colonies ranging from 5.9 x 108 CFU/ml to 5.9 x 102 CFU/ml. The detection limit for LAMP assay was 5.9 x 105 CFU/ml. (B) LAMP standard curve was generated for cell concentrations ranging from 5.9 x 105 to 5.9 x 108 CFU/ml. Figure 4. Sensitivity test for detection of pure culture Shigella by PCR assay. Lane M: 100bp DNA ladder; Lane 1: negative control; Lanes 2-8: ten-fold serial dilutions of TH 2/10 strain from 5.9 x 108 CFU/ml to 5.9 x 102 CFU/ml. The detection limit for PCR assay was 5.9 x 107 CFU/ml. 715 (A) (B) Figure 5. Sensitivity test for detection of ipaH gene of Shigella from spiked lettuce using real-time turbidimeter. (A) The curves from left to right indicate the decreasing concentration of CFU from bacterial colonies ranging from 3.6 x 10 CFU/g to 3.6 x 107 CFU/g. The detection limit for LAMP assay was 3.6 x 104 CFU/g. (B) LAMP standard curve was generated for cell concentrations ranging from 3.6 x 104 to 3.6 x 107 CFU/g. Sensitivity test and quantitative samples was 3.6 x 104 CFU/g. In contrast, the capabilities of LAMP and PCR PCR assay on spiked lettuce samples had a amplification in spiked lettuce detection limit of 3.6 x 105 CFU/g (data not When LAMP and PCR tests were done using shown). food homogenates without an overnight Figure 5B shows the standard curves of incubation, no positive result was obtained the tests on 10-fold serially diluted S. sonnei for spiked samples with cell density ranging strain TH 2/10 in spiked lettuce homogenates from 3.6 x 101 to 3.6 x 107 CFU/g (data not generated by the real-time turbidimeter. shown). However, after an overnight According to the standard curve, the incubation, there were amplifications with the correlation coefficient (R2) value for LAMP Tt values between 60 to 80 min for DNA assay was calculated to be 0.717. The R2 prepared from cell concentration starting value was not as high as the R2 value (0.908) from 3.6 x 104 to 3.6 x 107 CFU/g (Fig. 5A). for pure culture but it still indicates a linear The LAMP assay gave negative results for relationship between Shigella cell numbers samples with cell density ranging from 3.6 x (log CFU/g) and the amplification signals 10 1 to 3.6 x 10 3 CFU/g. Therefore, the (Tt values), whereby the Tt value decreases detection limits of the LAMP assay run in a as the cell numbers increases. real-time turbidimeter on spiked lettuce 716 DISCUSSION Both the studies showed high specificity and sensitivity but post amplification analysis The LAMP primers employed in our assay was needed to confirm the positive results. were designed to detect the ipaH gene of Soli and his colleagues (Soli et al., 2013) Shigella spp. This gene is located on a 4.6 kb evaluated the LAMP end-point detection HindIII fragment derived from the invasion methods, namely turbidity visualization, use plasmid, which encodes various invasion- of dye such as hydroxynaphthol blue (HNB) related outer membrane polypeptides (i.e., and SYBR Green I, and readings from the invasion plasmid antigens). The ipaH gene Loopamp Endpoint Turbidimeter. For end- not only exists as multiple copies on the point detection, their study showed that LAMP invasion plasmid of virulent Shigella, but can colorimetric detection methods have also be found in the chromosome (Buysse et equivalent or better sensitivity than al., 1995). This gene has been widely used visualization of precipitate or automated as a target in molecular methods for detecting turbidity readers. This suggested that Shigella spp. (Lüscher and Altwegg, 1994; colorimetric methods could be used as one Theron et al., 2001; Thong et al., 2005), of the inexpensive methods to interpret the including LAMP method. Notably, ipaH can results. Although LAMP assays have been also be found in a pathotype of E. coli, developed by others for Shigella spp., our enteroinvasive E. coli (EIEC) (Chapman et study was the first to use the real-time al., 2006). While assessing the specificity of turbidimeter for detection of this foodborne our assay primers, we observed non-Shigella pathogen and tested on artificially spiked samples that tested positive for ipaH, which food and the results were comparable to those likely reflects the presence of EIEC. Such studies. observation was also reported by Song et al. We found that temperature was a crucial (2005). The EIEC strain used in this study parameter during development of our LAMP was a kind gift of Gomez-Daurte (Gomez- assay. In order to increase the efficiency of Duarte et al., 2009). the assay, the LAMP primers (outer primers The first study to use the ipaH gene as FIP and BIP [F3 and B3]) were chosen using target gene to design the LAMP primers for LAMP primer design software so that the detection of Shigella was reported by Song melting temperatures (Tm) ranged from 60ºC and his colleagues (Song et al., 2005). Their to 65ºC. Indeed, the Bst DNA polymerase LAMP method efficiently detected the gene employed in this study functions optimally within 2 h with high specificity and sensitivity between these temperatures, facilitating (detection limit of 4 x 103 CFU/ml). We did primer annealing. Also, the large fragment of not use their LAMP primers in our study Bst DNA polymerase displays faster strand because our initial aim was to design loop displacement activity and is able to separate primers by using our own designed primers the non-template strand without use of a to shorten the amplification time by half or thermal cycler (Notomi et al., 2000). one third (Zhao et al., 2010). However the Nevertheless, Lim et al. (2013) reported that loop primers could not be developed as there the LAMP assay could be performed at were no suitable sequences. Although the temperatures as low as 58ºC. Notably, in the sensitivity in our study (5.9 x 105 CFU/ml) present study, a Loopamp Real-time was not as high as that reported in Song et al. Turbidimeter was used for real-time (2005), we used the real-time turbidimeter visualization of results based on turbidity which detected and recorded the turbidity graphs. values every 6 s without the end-point We observed that both the PCR-based detection such as gel electrophoresis and technique and the ipaH LAMP assay yielded product visualization methods. Later on, Shao 97% specificity and 100% sensitivity; et al. (2011) utilized the Song’s LAMP primers however, the detection limit for LAMP was to test for Shigella. The specificity reported 100-fold higher than PCR when tested on pure was in agreement with Song et al. (2005). bacterial cultures and 10-fold higher than 717 PCR when used on spiked lettuce samples. performed with simple equipment (e.g., water This may not be surprising when considering baths or controlled heating blocks), and that the sensitivity of PCR assays can be the results can be determined by direct affected by the presence of inhibitors, such visualization of white precipitate following as food components, media, or DNA centrifugation or changes in color upon extraction solutions (Rossen et al., 1992). addition of SYBR Green I. However, among Indeed, culture medium, biological these detection methods, real-time substances, and microflora have been shown turbidimeter monitoring is the only one that to have less effect on LAMP assays (Kaneko is potentially quantitative. Although previous et al., 2007; Mori et al., 2001; Ye et al., 2011). studies have examined the quantitative This is in agreement with findings by Wang capability of real-time LAMP for Vibrio et al. (2012) and Surasilp et al. (2011), who vulnificus and Salmonella spp. in pure illustrated the sensitivity of LAMP assays. culture and spiked food samples (Chen et al., In the present study, we could not detect 2011; Han et al., 2011), our study is the first or recover bacteria when we directly tested to demonstrate a good linear correlation the spiked lettuce samples without pre- coefficient (R2 = 0.7171–0.908) for LAMP- enrichment (results not shown). Similar based detection of Shigella in both pure observations have been reported by Jiménez culture and spiked lettuce samples, et al. (2010). This could be due to suggesting its quantitative capabilities. environmental stresses (e.g., starvation, In conclusion, we demonstrated that unsuitable incubation temperatures, or the specificity of LAMP- and PCR-based oxygen concentration), which can lead to non- detection methods for Shigella was culturable states (Oliver, 2005). Therefore, comparable. However, the sensitivity of the we applied enrichment steps using Gram- ipaH LAMP assay was much higher than negative (GN) broth, followed by plating on conventional PCR. Therefore, we have Salmonella–Shigella agar. GN broth is a developed a rapid and effective LAMP assay selective medium that preferentially allows that can be easily adapted for field detection the growth of enteric pathogens (e.g., of Shigella spp. Salmonella and Shigella) over normal flora (Taylor and Schelhart, 1969). Indeed, Acknowledgement. This study was funded performing enrichment steps can allow by UMRG (RP001-13BIO) and University of physiologically stressed or injured bacterial Malaya Post Graduate Research Fund (PPP) cells to multiply, thus increasing the (P0024/2012A). We would like to thank Koh likelihood of detection. Xiu Pei for technical assistance. Overall, the time required to perform the ipaH LAMP assay and to determine the end point was 2 h. Thus, it is more rapid than REFERENCES conventional PCR, which involves multiple steps (i.e., master mix preparation, Bardhan, P., Faruque, A.S., Naheed, A. & amplification, agarose gel electrophoresis, Sack, D.A. (2010). Decrease in and gel visualization) and requires shigellosis-related deaths without approximately 3 h to obtain positive results. Shigella spp.-specific interventions, Although the reaction time for our LAMP Asia. Emerging Infectious Diseases assay was shorter than PCR, it was longer 16: 1718-1723. than previously reported for other LAMP Buysse, J.M., Hartman, A.B., Strockbine, N. assays (> 60 min), especially when testing & Venkatesan, M. (1995). Genetic samples with low bacterial count. polymorphism of the ipaH multicopy Nevertheless, loop primers could be antigen gene in Shigella spps. and incorporated to shorten reaction times (Zhao enteroinvasive Escherichia coli. et al., 2010). In addition, instead of using the Microbial Pathogenesis 19: 335-349. real-time turbidimeter, LAMP assays can be 718 Chapman, T.A., Wu, X.Y., Barchia, I., Lim, K.T., Teh, C.S. & Thong, K.L. (2013). Loop- Bettelheim, K.A., Driesen, S., Trott, D., Mediated Isothermal Amplification Wilson, M. & Chin, J.J. (2006). Com- Assay for the Rapid Detection of parison of virulence gene profiles of Staphylococcus aureus. BioMed Escherichia coli strains isolated from Research International http://dx.doi.org/ healthy and diarrheic swine. Applied 10.1155/2013/895816. and Environmental Microbiology 72: Mori, Y., Kitao, M., Tomita, N. & Notomi, T. 4782-4795. (2004). Real-time turbidimetry of Chen, S., Wang, F., Beaulieu, J.C., Stein, R.E. LAMP reaction for quantifying template & Ge, B. (2011). Rapid detection of viable DNA. Journal of Biochemical and salmonellae in produce by coupling Biophysical Methods 59: 145-157. propidium monoazide with loop- Mori, Y., Nagamine, K., Tomita, N. & Notomi, mediated isothermal amplification. T. (2001). Detection of loop-mediated Applied and Environmental Micro- isothermal amplification reaction by biology 77: 4008-4016. turbidity derived from magnesium Gomez-Duarte, O.G., Bai, J. & Newel, E. pyrophosphate formation. Biochemical (2009). Detection of E. coli, Salmonella and Biophysical Research Communi- spp., Shigella spp., Yersinia cations 289: 150-154. enterocolitica, Vibrio cholerae, and Notomi, T., Okayama, H., Masubuchi, H., Campylobacter spp. enteropathogens Yonekawa, T., Watanabe, K., Amino, N. & by three-reaction multiplex PCR. Hase, T. (2000). Loop-mediated Diagnostic Microbiology and Infectious isothermal amplification of DNA. Nucleic Disease 63: 1-9. Acids Research 28: E63. Han, F., Wang, F. & Ge, B. (2011). Detecting Oliver, J.D. (2005). The viable but potentially virulent Vibrio vulnificus nonculturable state in bacteria. The strains in raw oysters by quantitative Journal of Microbiology 43: 93-100. loop-mediated isothermal amplification. Rossen, L., Norskov, P., Holmstrom, K. & Applied and Environmental Micro- Rasmussen, O.F. (1992). Inhibition of biology 77: 2589-2595. PCR by components of food samples, Jiménez, K.B., McCoy, C.B. & Achi, R. (2010). microbial diagnostic assays and DNA- Detection of Shigella in lettuce by the extraction solutions. International use of a rapid molecular assay with Journal of Food Microbiology 17: 37- increased sensitivity. Brazilian Journal 45. of Microbiology 41: 993-1000. Shao, Y., Zhu, S., Jin, C. & Chen, F. (2011). Kaneko, H., Kawana, T., Fukushima, E. & Development of multiplex loop-mediated Suzutani, T. (2007). Tolerance of loop- isothermal amplification-RFLP (mLAMP- mediated isothermal amplification to RFLP) to detect Salmonella spp. and a culture medium and biological Shigella spp. in milk. International substances. Journal of Biochemical and Journal of Food Microbiology 148: 75- Biophysical Methods 70: 499-501. 79. Kothary, M.H. & Babu, U.S. (2001). Infective Soli, K.W., Kas, M., Maure, T., Umezaki, M., dose of foodborne pathogens in Morita, A., Siba, P.M., Greenhill, A.R. & volunteers: a review. Journal of Food Horwood, P.F. (2013). Evaluation of Safety 21: 49-73. colorimetric detection methods for Li, J.W., Shi, X.Q., Chao, F.H., Wang, X.W., Shigella, Salmonella, and Vibrio Zheng, J.L. & Song, N. (2004). A study on cholerae by loop-mediated isothermal detecting and identifying enteric amplification. Diagnostic Microbiology pathogens with PCR. Biomedical and and Infectious Disease 77: 321-323. Environmental Sciences 17: 109-120. 719 Song, T., Toma, C., Nakasone, N. & Iwanaga, von Seidlein, L., Kim, D.R., Ali, M., Lee, H., M. (2005). Sensitive and rapid detection Wang, X., Thiem, V.D., Canh do, G., of Shigella and enteroinvasive Chaicumpa, W., Agtini, M.D., Hossain, A., Escherichia coli by a loop-mediated Bhutta, Z.A., Mason, C., Sethabutr, O., isothermal amplification method. FEMS Talukder, K., Nair, G.B., Deen, J.L., Kotloff, Microbiology Letters 243: 259-263. K. & Clemens, J. (2006). A multicentre Surasilp, T., Longyant, S., Rukpratanporn, study of Shigella diarrhoea in six S., Sridulyakul, P., Sithigorngul, P. & Asian countries: disease burden, clinical Chaivisuthangkura, P. (2011). Rapid manifestations, and microbiology. PLOS and sensitive detection of Vibrio Medicine 3: e353. vulnificus by loop-mediated isothermal Wang, L., Li, Y., Chu, J., Xu, Z. & Zhong, Q. amplification combined with lateral flow (2012). Development and application of dipstick targeted to rpoS gene. Molecular a simple loop-mediated isothermal and Cellular Probes 25: 158-163. amplification method on rapid detection Taylor, W.I. & Schelhart, D. (1969). Isolation of Listeria monocytogenes strains. of Shigellae. VII. Comparison of gram- Molecular Biology Reports 39: 445-449. negative broth with Rappaport’s World Health Organization (WHO). Initiative enrichment broth. Applied Microbiology for vaccine research (IVR): diarrheal 18: 393-395. diseases (updated February 2009). Theron, J., Morar, D., Du Preez, M., Brozel, Shigellosis. Accessed 21 Nov 2012. V.S. & Venter, S.N. (2001). A sensitive Available online: http://www.who.int/ seminested PCR method for the detection vaccine_research/diseases/diarrhoeal/ of Shigella in spiked environmental en/index6.html. water samples. Water Research 35: 869- Ye, Y., Wang, B., Huang, F., Song, Y., Yan, H., 874. Alam, M.J., Yamasaki, S. & Shi, L. (2011). Thong, K.L., Hoe, S.L., Puthucheary, S.D. & Application of in-situ loop-mediated Yasin, R. (2005). Detection of virulence isothermal amplification method for genes in Malaysian Shigella species by detection of Salmonella in foods. Food multiplex PCR assay. BMC Infectious Control 22: 438-444. Diseases 5: 8. Zhang, Y., Shan, X., Shi, L., Lu, X., Tang, S., Trofa, A.F., Ueno-Olsen, H., Oiwa, R. & Wang, Y., Li, Y., Alam, M.J. & Yan, H. Yoshikawa, M. (1999). Dr. Kiyoshi Shiga: (2011). Development of a fimY-based discoverer of the dysentery bacillus. loop-mediated isothermal amplification Clinical Infectious Diseases 29: 1303- assay for detection of Salmonella in 1306. food. Food Research International, U.S. Food and Drug Administration (FDA). doi:10.1016/j.foodres.2011.02.015. Food Bacteriological Analytical Manual: Zhao, X., Wang, L., Chu, J., Li, Y., Li, Y., Xu, Z., Chapter 6 Shigella. 2001 update. Li, L., Shirtliff, M.E., He, X. & Liu, Y. (2010). Accessed 21 Nov 2012. Available online: Development and application of a rapid http://www.fda.gov/Food/Science and simple loop-mediated isothermal Research/LaboratoryMethods/ amplification method for food-borne BacteriologicalAnalyticalManualBAM/ Salmonella detection. Food Science and ucm070789.htm. Biotechnology 19: 1655-1659. 720