Report Variable kinship patterns in Neolithic Anatolia revealed by ancient genomes Highlights Authors d Genetic kinship estimated from co-buried individuals’ Reyhan Yaka, Igor Mapelli, genomes in Neolithic Anatolia Damla Kaptan, ..., Anders Götherström, Füsun Özer, Mehmet Somel d Close relatives are common among co-burials in Asxıklı and Boncuklu Correspondence d Many unrelated infants found buried in the same building in

[email protected]

(A.G.),

[email protected]

(F.Ö.), Çatalhöyük and Barcın

[email protected]

(M.S.),

[email protected]

(R.Y.) d Neolithic societies in Southwest Asia may have held diverse concepts of kinship In brief Yaka et al. use ancient genomes from Neolithic Anatolia and present evidence for diverse concepts of social kinship in Neolithic societies. In some communities, like Çatalhöyük, many genetically unrelated infants were buried together inside the same buildings, whereas in other sites, people buried together were frequently close biological kin. Yaka et al., 2021, Current Biology 31, 1–14 June 7, 2021 ª 2021 Published by Elsevier Inc. https://doi.org/10.1016/j.cub.2021.03.050 ll Please cite this article in press as: Yaka et al., Variable kinship patterns in Neolithic Anatolia revealed by ancient genomes, Current Biology (2021), https://doi.org/10.1016/j.cub.2021.03.050 ll Report Variable kinship patterns in Neolithic Anatolia revealed by ancient genomes Reyhan Yaka,1,* Igor Mapelli,1,38 Damla Kaptan,1,38 Ayça Dog u,1,38 Maciej Chylen ski,2,38 Ömür Dilek Erdal,3 Dilek Koptekin,4 Kıvılcım Basxak Vural,1 Alex Bayliss,5,6 Camilla Mazzucato,7 Evrim Fer,8 Sevim Seda Çokog lu,1 Vendela Kempe Lagerholm,9,10 Maja Krzewin ska,10,11 Cansu Karamurat,12 Hasan Can Gemici,12 Arda Sevkar,3 xad Dag Nihan Dils tasx,1 Gülsxah Merve Kılınç,1,13 Donovan Adams,14 Arielle R. Munters,15,16 Ekin Sag lıcan,1 Marco Milella,17 Eline M.J. Schotsmans,18,19 Erinç Yurtman,1 Mehmet Çetin,1 Sevgi Yorulmaz,1 N. Ezgi Altınısxık,3,20 Ayshin Ghalichi,1,21 Anna Juras,2 C. Can Bilgin,1 Torsten Günther,15 Jan Storå,9 Mattias Jakobsson,15 Maurice de Kleijn,22 Gökhan Mustafaog lu,23 Andrew Fairbairn,24 Jessica Pearson,25 _Inci Togan,1 Nurcan Kayacan,26 Arkadiusz Marciniak,27 (Author list continued on next page) 1Department of Biological Sciences, Middle East Technical University (METU), Ankara, Turkey 2Institute , Poland of Human Biology and Evolution, Faculty of Biology, Adam Mickiewicz University, Poznan 3Department of Anthropology, Hacettepe University, Ankara, Turkey 4Department of Health Informatics, Middle East Technical University (METU) 5Scientific Dating, Historic England, London, UK 6Biological & Environmental Sciences, University of Stirling, Stirling, UK 7Department of Anthropology, Stanford University, Stanford, CA, 94303 USA 8Department of Genetics, University of Arizona, 85719, Tucson, AZ, USA 9Department of Archaeology and Classical Studies, Stockholm University, Stockholm, Sweden 10Centre for Palaeogenetics, Stockholm, Sweden 11Archaeological Research Laboratory, Department of Archaeology and Classical Studies, Stockholm University, Stockholm, Sweden 12Graduate School of Social Sciences, Middle East Technical University (METU), Ankara, Turkey 13Department of Bioinformatics, Graduate School of Health Sciences, Hacettepe University, 06100, Ankara, Turkey 14Department of Anthropology, University of Central Florida (Affiliations continued on next page) SUMMARY The social organization of the first fully sedentary societies that emerged during the Neolithic period in South- west Asia remains enigmatic,1 mainly because material culture studies provide limited insight into this issue. However, because Neolithic Anatolian communities often buried their dead beneath domestic buildings,2 household composition and social structure can be studied through these human remains. Here, we describe genetic relatedness among co-burials associated with domestic buildings in Neolithic Anatolia using 59 ancient genomes, including 22 new genomes from Asxıklı Höyük and Çatalhöyük. We infer pedigree relation- ships by simultaneously analyzing multiple types of information, including autosomal and X chromosome kinship coefficients, maternal markers, and radiocarbon dating. In two early Neolithic villages dating to the 9th and 8th millennia BCE, Asxıklı Höyük and Boncuklu, we discover that siblings and parent-offspring pairings were frequent within domestic structures, which provides the first direct indication of close genetic relation- ships among co-burials. In contrast, in the 7th millennium BCE sites of Çatalhöyük and Barcın, where we study subadults interred within and around houses, we find close genetic relatives to be rare. Hence, genetic relatedness may not have played a major role in the choice of burial location at these latter two sites, at least for subadults. This supports the hypothesis that in Çatalhöyük,3–5 and possibly in some other Neolithic com- munities, domestic structures may have served as burial location for social units incorporating biologically unrelated individuals. Our results underscore the diversity of kin structures in Neolithic communities during this important phase of sociocultural development. RESULTS AND DISCUSSION (c. 8,350–7,300 cal BCE)6–8 and Boncuklu (c. 8,300–7,600 cal BCE)9,10 (Figure 1A), which are among the earliest sedentary com- Our study focuses on social organization across two Neolithic munities in Central Anatolia. During the 9th millennium these sites periods. The Aceramic period is represented by As xıklı Höyük were characterized by small curvilinear buildings, and both Current Biology 31, 1–14, June 7, 2021 ª 2021 Published by Elsevier Inc. 1 Please cite this article in press as: Yaka et al., Variable kinship patterns in Neolithic Anatolia revealed by ancient genomes, Current Biology (2021), https://doi.org/10.1016/j.cub.2021.03.050 ll Report Clark Spencer Larsen,28 Ian Hodder,7 Çig dem Atakuman,29,39 Marin Pilloud,30,39 Elif Sürer,31,39 Fokke Gerritsen,32,39 Rana Özbal,33,39 Douglas Baird,25,39 Yılmaz Selim Erdal,3,20,39 Günesx Duru,34,39 Mihriban Özbasxaran,35,39 Scott D. Haddow,36,39 Christopher J. Knüsel,19,39 Anders Götherström,9,37,39,* Füsun Özer,3,20,39,* and Mehmet Somel1,39,40,* 15Human Evolution, Department of Organismal Biology, Uppsala University, 751 05 Uppsala, Sweden 16SciLife Lab, Uppsala University, 751 05 Uppsala, Sweden 17Department of Physical Anthropology, Institute of Forensic Medicine, University of Bern, Sulgenauweg 40, CH-3007 Bern, Switzerland 18Centre for Archaeological Science, University of Wollongong, Wollongong, Australia 19UMR 5199, De la Pre histoire à l’Actuel: Culture, Environnement et Anthropologie (PACEA), Universite de Bordeaux, Pessac, France 20Human G Lab, Department of Anthropology, Hacettepe University, Ankara, Turkey 21Department of Archaeogenetics, Max-Planck Institute for the Science of Human History, Kahlaische Strasse 10, D-07745, Jena, Germany 22Spatial Information Laboratory (SPINlab) at the Vrije Universiteit Amsterdam, Amsterdam, Netherlands 23Department of Archaeology, Faculty of Letters, Ankara Hacı Bayram Veli University, Abant 1 Cad. No:10/2D, Yenimahalle, Ankara 24School of Social Science, The University of Queensland, Michie Building, St Lucia, Brisbane, QLD, Australia 25Department of Archaeology, Classics and Egyptology, University of Liverpool, 8–14 Abercromby Square, Liverpool, L69 7WZ, UK 26Department of Prehistory, Faculty of Letters, Istanbul University, Ordu Cad. No: 6, 34459, Laleli, Istanbul 27Faculty of Archaeology, Adam Mickiewicz University, Poznan , Poland 28Department of Anthropology, Ohio State University, Columbus OH, USA 43210-1106 29Institute of Social Sciences, Middle East Technical University (METU), Ankara, Turkey 30Department of Anthropology, University of Nevada, Reno 31Department of Modeling and Simulation, Graduate School of Informatics, Middle East Technical University (METU), Ankara, Turkey 32Netherlands Institute in Turkey, Istanbul, Turkey 33Department of Archaeology and History of Art, Koç University, 34450 Istanbul, Turkey 34Mimar Sinan Fine Arts University, Istanbul 34134, Turkey 35Department of Prehistory, Istanbul University, Istanbul 34134, Turkey 36Department of Cross-Cultural and Regional Studies, University of Copenhagen, Copenhagen, Denmark 37Centre for Palaeogenetics, Stockholm, Sweden 38These authors contributed equally 39These authors contributed equally 40Lead Contact *Correspondence:

[email protected]

(R.Y.),

[email protected]

(A.G.),

[email protected]

(F.Ö.), msomel@metu. edu.tr (M.S.) https://doi.org/10.1016/j.cub.2021.03.050 maintained mainly forager subsistence practices. The subsequent well as FST, f3- and D-statistics25 (Figures S2A and S2B, S2D–S2F, Ceramic Neolithic period communities were increasingly reliant on and S3A–S3C, and Tables Z3-Z6) showed that As xıklı Höyük and food production, and they lived in larger settlements characterized Çatalhöyük people belonged to the Central and West Anatolian by rectilinear, clustered architecture. In our study, this later period early Holocene gene pool, represented by Boncuklu Höyük, Tepe- is represented by Çatalhöyük (c. 7,100–5,950 cal BCE),11–16 cik-Çiftlik, and Barcın Höyük individuals, as well as an Epipalaeo- Tepecik-Çiftlik (c. 7,500–5,800 cal BCE),17 and Barcın Höyük lithic Central Anatolian individual from Pınarbas xı.21 Within this (c. 6,600–6,000 cal BCE).18,19 For this study, we screened Neolithic regional group, we discern genetically distinct communities, such period human remains from As xıklı Höyük (n = 30) and Çatalhöyük that individuals from these sites (except for Tepecik-Çiftlik) tended (n = 60) by shotgun DNA sequencing. Owing to adverse conditions to share more recent common ancestry with individuals from the and the antiquity of the material, only n = 8 (26%) and n = 14 (23%) same settlement compared with those of other settlements (among skeletons (all petrous bones), respectively, contained R0.1% 576–11,780 D-tests per site, 84%–93% were nominally significant human DNA. These were directly deep sequenced or sequenced in this direction; Figures S3D–S3F and Table Z7). FST, f3- and D-sta- after enrichment by whole-genome capture probes, resulting in tistics also showed that residents of the two Aceramic Neolithic set- a total of 22 genomes with 0.013 to 5.03 coverage tlements, As xıklı Höyük and Boncuklu Höyük, were genetically high- (median = 0.093 ) (Tables 1 and Z1) (tables with the prefix ‘‘Z’’ ly similar to each other (Figures 1C, S2A, S2B, and S2D–S2F) are supplemental data tables, which can be found at Zenodo relative to Ceramic Neolithic-period populations. Data: https://doi.org/10.5281/zenodo.4587657). After confirming Aceramic Neolithic-period populations had lower within-group the authenticity of the data (Figure S1A and Table Z1), we com- genetic diversity (measured using the f3-statistic) than did bined them with published genomes from Boncuklu Höyük (n = Ceramic Neolithic groups (Figures 1D and S2C, and Tables Z8 9), Barcın Höyük (n = 23), and Tepecik-Çiftlik (n = 5)20–23 (Tables and Z9) and carried a higher fraction of short runs of homozygosity S1 and Z2). We integrated this with unpublished spatial and strat- (ROH) than most Ceramic Neolithic genomes (Figure S3G). This igraphic data from the archaeological sites. temporal increase in diversity, also noted in earlier studies,20 could be explained by two non-exclusive scenarios, namely population Increased genetic diversity from the Aceramic to the growth and genetic admixture. By testing D(Outgroup, X; Acer- Ceramic period amic Anatolian, Ceramic Anatolian), where X represents an early We first analyzed genetic relationships at the population level. Prin- Holocene Zagros or Levantine population, we found results cipal components analysis (Figure 1B), ADMIXTURE analysis,24 as compatible with southern and eastern gene flow into Central 2 Current Biology 31, 1–14, June 7, 2021 Please cite this article in press as: Yaka et al., Variable kinship patterns in Neolithic Anatolia revealed by ancient genomes, Current Biology (2021), https://doi.org/10.1016/j.cub.2021.03.050 ll Report Figure 1. Population relationships in Neolithic Anatolia (A) Geographic map of early Holocene SW Asian settlements with genome data used in the study (Table Z3). The map was created using ArcGIS Pro 2.4.0 (ArcGIS Pro is the intellectual property of Esri and is used herein under license. For more information about Esri software, please visit www.esri.com. Map sources: Esri, USGS, NOAA). (B) Principal components analysis (PCA) plot describing the genetic affinities among ancient populations studied. The genotype of each ancient individual was projected upon the first two PCs calculated using present-day West Eurasians. Colored dots represent ancient individuals. Figure S3B lists population labels of present-day individuals (gray dots). (C) Multidimensional scaling plot summarizing f3-statistic-based genetic distances between Anatolian populations (goodness of fit r2 = 0.92). (D) Boxplots showing within-population genetic distances (i.e., diversity) calculated using roughly contemporaneous individuals from each settlement (STAR Methods). Boxplot whiskers extend <1.5 times the interquartile range. (E) Population level D-statistics calculated as D(Yoruba, X; Aceramic, Ceramic), where Aceramic indicates Asxıklı and Boncuklu shown on the left-hand y axis, and Ceramic indicates Çatalhöyük, Barcın, or Tepecik-Çiftlik shown on the right-hand y axis, and X stands for ancient populations from the Levant and Iran, shown in the middle. Negative or positive D values indicate higher genetic affinity between X and Aceramic or Ceramic Neolithic Anatolians, respectively. Darker colors show nominally significant D-statistics with |Z| R3, and lighter colors show non-significant values. Error bars show ± 1 standard error. See also Figures S2 and S3 and Tables Z1–Z5, Z8–Z9. and West Anatolia between roughly 7,500 and 6,500 cal BCE (Fig- societies frequently interred their dead, including subadults and ure 1E and Table Z4) as previously suggested.21,26 Using qpAdm, adults of both sexes, beneath the floors of these buildings while we could also model Ceramic Neolithic Anatolian populations as they were inhabited by the living.1,28,29 A common assumption mixtures of c.90% Aceramic Neolithic Anatolian ancestry has been that these burials were of household members who (estimate ± 1 standard error: 89%–92% ± 2%–4%) and c.10% Le- were related in some way, possibly genetically or through social vantine ancestry (8%–11% ± 2%–4%) (models that included Za- kinship.27,30,31 However, it is not yet clear if individuals buried un- gros or Caucasus populations were not supported) (Table Z10). der house floors necessarily lived in those structures as part of a Notably, the timing of increased population mobility is contempo- single co-resident group32 (STAR Methods). The extent of dietary raneous with a stronger reliance on agriculture and animal similarity among individuals interred within the same building, for husbandry as food sources, a shift to larger buildings, likely pop- instance, is currently ambiguous.33,34 Nevertheless, the assem- ulation growth, and possible shifts in patterns of social organiza- blage of burials within or around domestic structures is expected tion, as we describe below. to carry information about household composition and/or burial practices, and it may shed light on the relative importance of ge- Estimating pedigree relationships among Neolithic netic relatedness as an organizing principle within these early co-burials Neolithic communities. In previous studies at Çatalhöyük, ana- Neolithic Southwest Asian settlements contain structures that are lyses of dental morphometrics and of mitochondrial DNA have usually interpreted as domestic dwellings that served as focal suggested that individuals interred within the same building are points for the socialization of household members.27 These often not genetically closely related.3–5 The question has remained Current Biology 31, 1–14, June 7, 2021 3 Please cite this article in press as: Yaka et al., Variable kinship patterns in Neolithic Anatolia revealed by ancient genomes, Current Biology (2021), https://doi.org/10.1016/j.cub.2021.03.050 ll Report Table 1. Archaeological, osteological, and genetic characteristics of sequenced individuals Calibrated Mitochondrial 14 Stratigraphic C date Molecular Genome DNA Y chromosome Individual ID Site level / area Building (cal. BCE) Age class sex coverage haplogroup haplogroup 2 xıklı Höyük 2A As AB 7585–7475 (95%) Young adult XX 0.02 H2a2a - 33 xıklı Höyük 2C As C 7945–7890 (9%) Child XY 0.07 U3a G2a2b 7870–7595 (86%) 40 xıklı Höyük 2B As BH 7935–7915 (1%) Old adult XX 0.03 N1a1a1 - 7825–7590 (94%) 128 xıklı Höyük 4 As B3 8225–7955 (95%) Child XX 5.03 K1a4 - 129 xıklı Höyük 4 As B3 8170–8115 (6%) Young adult XX 0.79 K1a4 - 8060–8045 (1%) 8010–7985 (1%) 7970–7735 (86%) 133 xıklı Höyük 4 As B1 8170–8115 (8%) Old adult XX 1.16 K1a4 - 8060–8040 (1%) 8010–7980 (2%) 7975–7735 (84%) 131 xıklı Höyük 4 As B1 8200–8110 (16%) Child XX 0.09 T2c1a - 8095–8035 (7%) 8015–7740 (72%) 136 xıklı Höyük 4 As B1 8175–8110 (7%) Adult XX 0.15 T2c1a - 8090–8075 (1%) 8065–8040 (1%) 8015–7705 (84%) 7695–7655 (2%) 30006 F.7615 Çatalhöyük North G 114 6645–6495 (94%) Infant XX 0.07 K1a4 - 6490–6480 (1%) 8587 F.1013 Çatalhöyük North G 114 - Neonate XX 0.14 T2e - 2728 F.258 Çatalhöyük South M 50 6695-6505 (95%) Infant XX 0.08 K1a - 2842 F.274 Çatalhöyük South M 50 6690-6505 (95%) Child XX 0.09 K1a - 2017 F.96 Çatalhöyük South M 50 6815–6790 (2%) Neonate XX 0.03 T2 - 6775–6595 (93%) 1885 F.84 Çatalhöyük South M 50 6905–6885 (1%) Child XY 0.07 K1a G2a2a1 6825–6635 (92%) 6625–6600 (2%) 2033 F.84/86 Çatalhöyük South M 50 6690–6590 (95%) Child XY 0.01 H2a2a1d H3a1 2779 F.265 Çatalhöyük South M 50 - Infant XY 0.27 H2a2a C1a2 5357 F.576 Çatalhöyük South K 17 7035–6680 (93%) Infant XY 0.06 N1a1a1 C1a2 6670–6650 (2%) 21855 F.8214 Çatalhöyük South K 17 - Child XX 0.07 H2a2a1 - 21981 F.8153 Çatalhöyük South N 89 - Infant XX 0.09 K1a17 - 5747 F.1064 Çatalhöyük South M 91 6640–6490 (95%) Infant XX 0.12 T2c1 - 11739 F.1912 Çatalhöyük TP Q-R - 6235–6075 (95%) Middle adult XX 0.20 K1b1 - 20217 F.3931 Çatalhöyük TP Q-R - 6415–6240 (95%) Child XX 0.06 K1a4b - The ‘‘individual ID’’ column indicates excavation IDs, including feature number (‘‘F.’’) for Çatalhöyük individuals. For details of the radiocarbon dating see Table Z2. Age codes indicate infant: 2 months–3 years; child: 3–12 years; adolescent: 12–20 years; young adult: 20–35 years; middle adult: 35–50 years; old adult: 50+ years. See also Figure S1 and Tables Z1 and Z2. unresolved, however, due to the inability of either data type to suf- Second, to distinguish different pedigree relationships among pu- ficiently identify exact pedigree relationships on any one site. tative first-degree pairs (e.g., siblings, mother-son, father- Here, we re-address the question of co-burial relationships us- daughter), we used the probabilities of sharing 0, 1, or 2 alleles ing genome data from Neolithic Anatolian communities. In order to identical-by-descent (Cotterman coefficients; k0, k1, k2), although infer reliable pedigree relationships, we used different sources of the low coverage of our genome data constrained the utility of this information simultaneously. First, we employed three allele fre- latter approach (Tables S2 and Z11). Therefore, for inferring pedi- quency-based methods to infer genetic kinship coefficients: gree relationships we combined (a) kinship coefficients (q) esti- NgsRelate,35 lcMLkin,36 and READ37 (Figures 2, S4A, and S4B). mated from autosomal and from X chromosomal loci, (b) 4 Current Biology 31, 1–14, June 7, 2021 Please cite this article in press as: Yaka et al., Variable kinship patterns in Neolithic Anatolia revealed by ancient genomes, Current Biology (2021), https://doi.org/10.1016/j.cub.2021.03.050 ll Report A B C D Figure 2. Genetic relatedness estimation among co-buried individuals using genomic data (A) Autosomal kinship coefficients (q) between pairs of individuals calculated using three different software programs. The horizontal black lines indicate expected autosomal q values for first- and second-degree related and unrelated pairs. The high estimates for the Asxıklı 128–133 pair may be influenced by inbreeding (STAR Methods). The horizontal colored bars indicate expected q ranges for different degrees of relatedness estimated using simulations with 5,000 SNPs (95% confidence interval). Figure S4B presents the same results, where simulations were performed using the same SNP numbers per pair. (B) Autosomal versus X chromosomal kinship coefficients (q) between pairs calculated with NgsRelate. The vertical bars on the right indicate expected q ranges for different degrees of relatedness estimated using simulations with 5,000 autosomal SNPs, while the horizontal bars on the top indicate expected q ranges for different types of relatedness estimated using simulations with 800 X chromosome SNPs (empirical 95% bootstrap confidence interval). The horizontal and vertical point-bars describe uncertainty in autosomal and X chromosomal q estimates, respectively, calculated by bootstrapping SNPs 100 times (Table Z12). (C) Probabilities of sharing 0, 1, or 2 autosomal alleles identical-by-descent (Cotterman coefficients; k0, k1, k2) between pairs of individuals calculated with NgsRelate. The gray dots indicate expected values based on simulation. The estimated pedigree relationships reflect joint evaluation of different information (e.g., age at death) in addition to Cotterman coefficients (Table S3). (D) Frequencies of individuals found in co-burial clusters with or without close relatives identified (Figure 3), among all co-buried individuals tested genetically in a site. (*) indicates p < 0.05. Including the Tepecik-Çiftlik data in the Aceramic period versus Ceramic period comparison yields an odds ratio = 6.6 and p = 0.054. See also Figures S1 and S4 and Tables S1–S3, Z11, Z12, Z16–Z19. mitochondrial haplotype sharing, (c) osteological age-at-death es- The final dataset included a total of 223 pairs of individuals timates, and (d) radiocarbon dates (Table S3) (STAR Methods). buried within the same sites, who were broadly contempora- Finally, we performed pedigree simulations to determine the po- neous, and who had sufficient genomic data for reliably infer- wer of kinship coefficient estimation using low coverage data (Fig- ring genetic relatedness (Tables S1, S3, and Z11). Of these, ure S4C). In addition, we studied the performance of the kinship co-burials comprised 32 individuals and 50 pairs, including 2– estimation algorithms on negative controls, that is, real data 6 burials associated with the same building or building clusters from pairs of individuals who could historically not be close rela- (i.e., co-burials). In Çatalhöyük and Barcın, co-buried individ- tives (STAR Methods). We hence limited the kinship tests to pairs uals who could be genetically sampled only included sub- of individuals sharing a minimum of 5,000 single nucleotide poly- adults. Importantly, all these buildings either had evidence of morphisms (SNPs) (Figure S1B). This permits reliable estimations domestic use (e.g., hearths) or lacked evidence of systematic of genetic relatedness up to the 3rd degree (e.g., cousins). Pairs non-domestic use (e.g., use as animal penning), and did not related beyond the 3rd degree are here referred to as ‘‘unrelated’’ deviate from others of the same layer in terms of structure or (STAR Methods). elaboration. Current Biology 31, 1–14, June 7, 2021 5 Please cite this article in press as: Yaka et al., Variable kinship patterns in Neolithic Anatolia revealed by ancient genomes, Current Biology (2021), https://doi.org/10.1016/j.cub.2021.03.050 ll Report Figure 3. Relatedness among co-buried individuals in (A) Asxıklı Höyük, (B) Boncuklu Höyük, (C) Çatalhöyük, (D) Barcın Höyük The plans show buildings where burials with identified close relatives are shown in red, burials with no identified relatives in blue, and burials for which no DNA data was available, in gray. Building numbers are shown starting with ‘‘B.’’ The figure indicates the most likely inferred relationships, described in Table S3. See also Figure S4 and Tables S1–S3, Z11, and Z12. Co-buried pairs in Aceramic period sites frequently 131). The other pair, buried in separate but proximate buildings, include relatives included an old adult and child (individual 133 and 128). The ge- The data from As xıklı Höyük included genomes of five individuals netic and skeletal evidence indicated both pairs to be sisters from the same stratigraphic layer who produced statistically (Figures 2A–2C and Tables S3 and Z11). However, we cannot consistent radiocarbon ages (c2 = 7.6, c 2(5%) = 9.5, n = 4; Table exclude parent-offspring relationships. An adult female (individ- Z2) and could have lived at the same time. These individuals, all ual 129), buried in the same building as individual 128, had no females, were interred in two buildings in close proximity and genetically close relatives among the other four individuals. that shared a workspace, likely used by a single household6 (Fig- Thus, although only a minority of studied individual pairs (2 of ure 3A). All three methods identified two pairs of first-degree rel- 10 pairs) were closely related, the majority of individuals studied atives (Figure 2A, and Tables S3 and Z11). One pair buried in the (4 out of 5) had one close relative identified in the same or adja- same building included an adult and child (individuals 136 and cent building (Figure 2D and Table S1). 6 Current Biology 31, 1–14, June 7, 2021 Please cite this article in press as: Yaka et al., Variable kinship patterns in Neolithic Anatolia revealed by ancient genomes, Current Biology (2021), https://doi.org/10.1016/j.cub.2021.03.050 ll Report The Boncuklu Höyük data comprised nine genomes of individ- 3.8, n = 1), and which suggest that it is 96% probable that the uals who were buried in three buildings or in external spaces. woman (individual 37) died first (Table Z2). Five individuals formed a co-burial cluster in two adjacent consecutive buildings (Figure 3B). Among these, two pairs of Temporal or age-dependent variability in co-burial first-degree relatives were identified (Figures 2A–2C; Tables S3 kinship patterns and Z11) (also reported earlier21). The first were a possible The identification of multiple instances of close genetic related- mother and her adult son (individuals ZHF and ZHJ) and were ness among co-burials across all Neolithic Anatolian settlements buried in the same building (B14). Their radiocarbon results studied suggests that early Neolithic social arrangements and were different at the 1% significance level (c2 = 8.8, c2 (5%) = possibly household composition were to some extent linked to 3.8, n = 1; Table Z2), and suggested that the woman (ZHJ) genetic ties. Although long assumed,38 genetic relatedness died first with 90% probability. The second included a possible within Neolithic house-related social groups is documented pair of adult male and female siblings (individuals ZHBJ and here directly for the first time. This is particularly salient in the ev- ZHAF). These individuals were buried in the proximate consecu- idence from 9th and early 8th millennium As xıklı Höyük and Bon- tive buildings (B12 and B14). Thus, as at Asxıklı Höyük, we could cuklu Höyük and could be considered suggestive of elements of identify close relatives across the majority of individuals (4 out of close genetic kin relationships among groups buried together 5) associated with neighboring building pairs (Figure 2D and Ta- within Aceramic Neolithic houses. ble S1). The only exception was a perinatal infant (individual Nevertheless, a notable fraction of our sample also contained ZHAG). Intriguingly, this infant was buried in the same grave individuals (nearly all subadults) buried in buildings together with with an adult female (individual ZHAF). The infant also shared genetically unrelated individuals (50% of 32 individuals; Figure 3). the woman’s mitochondrial haplotype but was closely related Genetic relatedness among co-burials was especially low in the to neither the woman nor any other individual studied. Other in- 7th millennium cal BCE Çatalhöyük and Barcın Höyük, with the dividuals also lacked close relatives in this dataset. majority of co-burials lacking identifiable genetically related kin (the sample size from Tepecik-Çiftlik is too small to reach a Relatives are rare among Çatalhöyük and Barcın general conclusion). Indeed, the combined frequencies of indi- intramural burials viduals among co-burials with and without identified relatives The Çatalhöyük data contained genomes of 14 individuals from appeared different between As xıklı and Boncuklu versus Çata- multiple stratigraphic levels. All except one individual were sub- lhöyük and Barcın Höyük (odds ratio = 8.6, Fisher’s exact test adults; 10 and 4 were genetically determined to have been fe- p = 0.019; Figure 2D and Table S1). However, the difference be- males and males, respectively. Ten subadults, buried in three comes non-significant when including the co-buried adult pair buildings dating to the mid-7th millennium BCE, constituted from Tepecik-Çiftlik in the temporal comparison between Acer- three co-burial clusters (Figure 3C). We identified a single pair amic and Ceramic period sites (odds ratio = 6.6 and p = 0.054). of female siblings (individuals 2728 and 2842), an infant and a Two points need further mention. First, although all age groups child, buried within the same building (Building 50) (Figures 2A– are represented archaeologically among Çatalhöyük and Barcın 2C, and Tables S3, Z2 and Z11). The pair produced statistically Höyük burials, among samples with sufficient DNA data we had consistent radiocarbon measurements (c2 = 0.0, c2 (5%) = 3.8, high proportions of subadults (13/14 and 16/23, respectively). n = 1). None of the other pairs of individuals tested were closely This effect appears to be caused by better DNA preservation in related. Hence, among Çatalhöyük individuals co-buried in these subadult bones, at least at Çatalhöyük (Figure S1C; STAR three buildings and tested genetically, only 2 out of 10 had ge- Methods), possibly as a result of age-based differences in burial netic kin identified (Figure 2D and Table S1). treatment.39,40 As a consequence, in our study, no adult co- The Barcın Höyük data included genomes of 23 individuals burials could be genetically examined from these two sites. Sec- from multiple phases (VIa, VIb and VIc or VId2/3) (Figure 3D). ond, Çatalhöyük and Barcın Höyük buildings were significantly Ten of these individuals were inserted into three or possibly larger and contained more burials than those of the Aceramic four buildings (Table Z2). We determined two pairs of relatives, Neolithic sites (Figure 3). including a pair of subadult sisters (associated with Building 5) The infrequency of close relatives among subadults buried and a pair of subadult males who were second- or third-degree together in relatively large structures at Çatalhöyük and Barcın relatives (associated with Buildings 14/15) (Figures 2A–2C and Höyük is intriguing. It raises the question of whether these build- Tables S3 and Z11). Both pairs were buried in close proximity ings may have been used by extended families, such that the to each other and produced statistically consistent radiocarbon co-buried subadults could be distant cousins who were not iden- measurements (L11 213 & 215, c2 = 0.7; M10 271 & 275, c2 = 0.2, tified by the methods employed. We thus tested whether individ- c2 (5%) = 3.8, n = 1 for both; Table Z2). None of the other individ- uals buried in closer proximity shared greater genetic similarity, uals had close relatives identified, including four infants buried in using genetic distances based on the f3-statistic (STAR Building 4. Hence, among co-buried individuals we could identify Methods). After excluding close relatives, we found no correla- relatives for only 4 out of 10 (Figure 2D and Table S1). tion between genetic distance and spatial distance across burial The Tepecik-Çiftlik data included genomes of a total of five in- pairs in either Çatalhöyük or Barcın Höyük (Pearson r < 0.02, dividuals from two strata. We identified a probable pair of a Mantel test p > 0.3; Table S4). We also tested the hypothesis mother and her adult son (individuals 37 and 21) buried in that overall genetic similarity among co-burials might be higher different parts of the same building (Building AY/AK) (Tables S3 within buildings than between buildings. Again, we found no ev- and Z11). These individuals produced radiocarbon results that idence for this (one-sided permutation test p > 0.8; Table S4). are different at the 1% significance level (c2 = 8.0, c2 (5%) = These results corroborate previous analyses that found no Current Biology 31, 1–14, June 7, 2021 7 Please cite this article in press as: Yaka et al., Variable kinship patterns in Neolithic Anatolia revealed by ancient genomes, Current Biology (2021), https://doi.org/10.1016/j.cub.2021.03.050 ll Report significant correlation between burial location and dental similar- parallel with changes in subsistence and population mobility, ities in Neolithic Çatalhöyük adults3,4,41 and also a lack of mito- genetic relatedness may have become less important in the chondrial DNA shared among co-burials.5 We note that we do structuring of intramural burial traditions. not expect all individuals associated with these buildings to have been buried within those structures. Also, not all individuals STAR+METHODS interred in these buildings could be sampled in this study. Still, the presence of individuals without identified relatives implies Detailed methods are provided in the online version of this paper that the choice of the same structure for the burial of community and include the following: members may be motivated, among other factors, by additional forms of social connectedness.42,43 For instance, co-burials, d KEY RESOURCES TABLE including juveniles, may have included ‘‘adoptive, foster or fictive d RESOURCE AVAILABILITY kin held together by memory and history making’’44. Accord- B Lead Contact ingly, co-burial and perhaps household composition in these B Materials Availability later Neolithic settlements may have included—but also d EXPERIMENTAL MODEL AND SUBJECT DETAILS extended beyond—close genetic kin. It is also possible that B Archaeological background the practice of co-burying subadults with genetically unrelated B Description of archaeological sites individuals was already present in the Aceramic period in Anato- B Description of archaeological material lia, but we did not sample these sufficiently in Asxıklı and Boncu- d METHOD DETAILS klu. Indeed, the Boncuklu adult female-infant pair sharing a B Radiocarbon dating grave, found to be unrelated, may reflect such a tradition. It B Molecular biology laboratory methods therefore remains unclear, yet, whether the difference among d QUANTIFICATION AND STATISTICAL ANALYSIS sites in co-burial patterns reflects a temporal shift or differential B Sequence read processing treatment of adults versus subadults in Neolithic Anatolia. B Authentication of data, contamination estimates and molecular sex determination Varying traditions linking sex and space B Mitochondrial DNA and Y chromosome analyses Another set of observations involves burial patterns with respect B Dataset processing to sex. First, we find co-burial of closely related adults of both B Population genetic analyses sexes at Boncuklu Höyük and possible adult-child sister pairs B Estimating genetic relatedness and pedigree relation- at As xıklı Höyük. Although our sample size is limited to reach a ships definitive conclusion, it is worth noting that the pattern is consis- xıklı-128 B Inferring phenotypic traits and inbreeding for As tent with adult females retaining close ties to their natal house- B Estimating the expected ranges for kinship coefficients holds, symbolically or residentially, over significant periods of using simulations their lives. This scenario, at least at Boncuklu Höyük, could B Spatial distances versus genetic distances among equally have applied to the males. Second, the sex patterning burials observed in Anatolian Neolithic burials appear distinct from SUPPLEMENTAL INFORMATION those described for Neolithic and Bronze Age cemeteries in Eu- rope, where male burials predominate,45,46 and patrilocality is Supplemental information can be found online at https://doi.org/10.1016/j. evident.37,47,48 For instance, in a study of multiple cemeteries, cub.2021.03.050. Mittnik and colleagues identified only 2 first-degree related fe- male pairs out of 21 first-degree relationships.48 This proportion ACKNOWLEDGMENTS is different in our data, which reveals 4 first-degree related fe- male pairs out of 7 first-degree relationships (odds ratio = 11.1, We thank all colleagues at the METU CompEvo and Hacettepe Human_G groups, and Özlen Konu for helpful discussion, the Konya Museum and the Fisher’s exact test p = 0.02) (Table Z13). This result, as well as Ministry of Culture of Turkey for permissions, and three anonymous reviewers the contrast between co-burial of related adult females in the for suggestions. Funding: The work was supported by ERC (Consolidator Aceramic period buildings and the stark patrilocal patterns in Grant no. 772390 to M.S.), EMBO (Short-Term Fellowship grant no. STF 6th-3rd millennium European cemeteries, are consistent with 7909 to R.Y.), TÜBITAK of Turkey (grant no. 117Z229 to M.S.), AHRC/NSF the notion that sex role differences intensified following the initial (AH/M008908/1 to A.B. and I.H.), NCN of Poland (grants no. 2012/06/M/ adoption of agriculture.49 Meanwhile, both sister pairs we iden- HS3/00286 to A.M., 2017/24/T/HS3/00511, and 2014/15/N/HS3/01272 to M.Ch.), National Science Foundation of the USA (Senior Biological Anthropol- tified at Barcın and Çatalhöyük were subadults. In this regard, ogy, NSF BCS-1827338 to M.P.), the French State via the ‘Investments for the patrilocal traditions in Ceramic period Anatolian sites remain a Future’ framework program, Initiative d’Excellence de l’Universite de possibility (as suggested earlier based on dental and mtDNA Bordeaux (IdEx) (Award No. ANR-10-IDEX-03-02 to C.J.K). data3,5). In summary, in addition to evidence for the existence of close AUTHOR CONTRIBUTIONS genetic ties among putative households in the Aceramic period, (a) R.Y., I.M., M.Ch., _I.T., Ç.A., M.P., E.Sü., F.G., R.Ö., D.B., Y.S.E., G.D., M.Ö., we find that genetic relatedness among subadult co-burials was S.D.H., C.J.K., A.Gö., F.Ö., and M.S. conceived and designed the study and infrequent at Ceramic period Çatalhöyük and Barcın. Although experiments, with contributions by J.S., A.Ma., C.S.L., and I.H.; (b) Ö.D.E., we cannot yet pinpoint when and where this latter practice N.K., A.Ma., C.S.L., I.H., Y.S.E., G.D., M.Ö., S.D.H., and C.J.K. provided the emerged, it appears plausible that during the transition from osteoarchaeological material; (c) M.Ch., Ö.D.E., M.M., E.M.J.Sc., Y.S.E., the Aceramic to the Ceramic Neolithic period in Anatolia, in S.D.H., and C.J.K. prepared the osteoarchaeological material; (d) C.M., A.B., 8 Current Biology 31, 1–14, June 7, 2021 Please cite this article in press as: Yaka et al., Variable kinship patterns in Neolithic Anatolia revealed by ancient genomes, Current Biology (2021), https://doi.org/10.1016/j.cub.2021.03.050 ll Report C.K., H.C.G., D.A., Ç.A., M.P., F.G., R.Ö., D.B., Y.S.E., G.D., M.Ö., S.D.H., and 9. Baird, D., Fairbairn, A., Jenkins, E., Martin, L., Middleton, C., Pearson, J., C.J.K. compiled and analyzed archaeological data, with contributions by Asouti, E., Edwards, Y., Kabukcu, C., Mustafaog lu, G., et al. (2018). M.deK., G.M., A.F., J.P., and N.K.; (e) R.Y., A.D., M.Ch., D.Ka., and N.D.D. per- Agricultural origins on the Anatolian plateau. Proc. Natl. Acad. Sci. USA formed molecular biology laboratory experiments, with contributions and sup- 115, E3077–E3086. https://doi.org/10.1073/pnas.1800163115. port from V.K.L., M.K., and S.Y., supervised by A.G., F.Ö., and M.S.; (f) R.Y., 10. Baird, D., Fairbairn, A., and Martin, L. (2017). The animate house, the I.M., K.B.V., D.Ko., E.F., S.S.Ç., G.M.K., A.D., A.S., and M.S. analyzed genetic institutionalization of the household in Neolithic central Anatolia. data and performed simulations, with contributions and support from M.Ch., World Archaeol. 49, 753–776. https://doi.org/10.1080/00438243. N.D.D., M.Çe., E.Y., A.R.Mu., E.K., A.Gh., T.G., and M.J., supervised by 2016.1215259. N.E.A., E.Sü., A.G., F.Ö., and M.S.; (g) Ç.A., M.P., E.Sü., F.G., R.Ö., D.B., 11. Bayliss, A., Brock, F., Farid, S., Hodder, I., Southon, J., and Taylor, R.E. Y.S.E., G.D., M.Ö., S.D.H., C.J.K., A.Gö., F.Ö., and M.S. supervised the study, (2015). Getting to the Bottom of It All: A Bayesian Approach to Dating the with contributions by C.C.B., A.J., and A.Ma.; (h) R.Y., I.M., M.M., Ç.A., M.P., Start of Çatalhöyük. J. World Prehist. 28, 1–26. https://doi.org/10.1007/ E.Sü., F.G., R.Ö., D.B., Y.S.E., G.D., M.Ö., S.D.H., C.J.K., A.Gö., F.Ö., and s10963-015-9083-7. M.S. wrote the manuscript with contributions from all authors. ski, M.Z., Bayliss, A., Czerniak, L., Goslar, T., 12. Marciniak, A., Baran Southon, J., and Taylor, R.E. (2015). Fragmenting times: Interpreting a DECLARATION OF INTERESTS Bayesian chronology for the Late Neolithic occupation of Çatalhöyük East, Turkey. Antiquity 89, 154–176. https://doi.org/10.15184/aqy. The authors declare no competing interests. 2014.33. INCLUSION AND DIVERSITY 13. Cessford, C., and Carter, T. (2005). Quantifying the consumption of obsidian at Neolithic Çatalhöyük, Turkey. J. Field Archaeol. 30, One or more of the authors of this paper self-identifies as a member of the 305–315. https://doi.org/10.1179/009346905791072279. LGBTQ+ community. The author list of this paper includes contributors from 14. Cessford, C. (2005). Estimating the Neolithic population of Çatalhöyük. In the location where the research was conducted who participated in the data Inhabiting Çatalhöyük: Reports from the 1995-99 Seasons, I. Hodder, ed. collection, design, analysis, and/or interpretation of the work. (McDonald Institute for Archaeological Research. British Institute for Archaeology at Ankara), pp. 323–326. Received: September 19, 2020 15. Hodder, I. (2000). Towards reflexive method in archaeology: the example Revised: January 8, 2021 at Çatalhöyük, I. Hodder, ed. (McDonald Institute for Archaeological Accepted: March 15, 2021 Research, University of Cambridge). Published: April 14, 2021 16. Düring, B.S. (2010). The prehistory of Asia minor: From complex hunter- gatherers to early urban societies (Cambridge University Press). https:// REFERENCES doi.org/10.1017/CBO9780511778926. 17. Bıçakçı, E., Godon, M., and Çakan, Y.G. (2012). Tepecik-Çiftlik. In The 1. Kuijt, I. (2000). People and Space in Early Agricultural Villages: Exploring Neolithic in Turkey, M. Özdog an, P.I. Kuniholm, and N. Basxgelen, eds. Daily Lives, Community Size, and Architecture in the Late Pre-Pottery (Archology and Art Publications), pp. 89–134. Neolithic. J. Anthropol. Archaeol. 19, 75–102. https://doi.org/10.1006/ jaar.1999.0352. 18. Gerritsen, F., and Özbal, R. (2019). Barcın Höyük, a seventh millennium settlement in the Eastern Marmara region of Turkey. Doc. Praehist. 46, 2. Boz, B., and Hager, L.D. (2013). Living above the Dead: Intramural Burial 58–67. https://doi.org/10.4312/dp.46.4. practices at Çatalhöyük. In Humans and Landscapes of Çatalhöyük: Reports from the 2000-2008 Seasons, I. Hodder, ed. (Cotsen Institute 19. Özbal, R., and Gerritsen, F. (2019). Barcın Höyük in Interregional of Archaeology), pp. 413–440. Perspective: An Initial Assessment. In Concluding the Neolithic: The Near East in the Second Half of the Seventh Millennium BCE, A. 3. Pilloud, M.A., and Larsen, C.S. (2011). ‘‘Official’’ and ‘‘practical’’ kin: Marciniak, ed. (Lockwood Press), pp. 287–305. https://doi.org/10. Inferring social and community structure from dental phenotype at 2307/j.ctvd1c967.16. Neolithic Çatalhöyük, Turkey. Am. J. Phys. Anthropol. 145, 519–530. https://doi.org/10.1002/ajpa.21520. 20. Kılınç, G.M., Omrak, A., Özer, F., Günther, T., Büyükkarakaya, A.M., 4. Larsen, C.S., Knüsel, C.J., Haddow, S.D., Pilloud, M.A., Milella, M., Bıçakçı, E., Baird, D., Dönertasx, H.M., Ghalichi, A., Yaka, R., et al. Sadvari, J.W., Pearson, J., Ruff, C.B., Garofalo, E.M., Bocaege, E., (2016). The Demographic Development of the First Farmers in Anatolia. et al. (2019). Bioarchaeology of Neolithic Çatalhöyük reveals fundamental Curr. Biol. 26, 2659–2666. https://doi.org/10.1016/j.cub.2016.07.057. transitions in health, mobility, and lifestyle in early farmers. Proc. Natl. 21. Feldman, M., Fernández-Domı́nguez, E., Reynolds, L., Baird, D., Acad. Sci. USA 116, 12615–12623. https://doi.org/10.1073/pnas. Pearson, J., Hershkovitz, I., May, H., Goring-Morris, N., Benz, M., 1904345116. Gresky, J., et al. (2019). Late Pleistocene human genome suggests a 5. Chylenski, M., Ehler, E., Somel, M., Yaka, R., Krzewin ska, M., Dabert, M., local origin for the first farmers of central Anatolia. Nat. Commun. 10, Juras, A., and Marciniak, A. (2019). Ancient mitochondrial genomes 1218. https://doi.org/10.1038/s41467-019-09209-7. reveal the absence of maternal kinship in the burials of Çatalhöyük peo- 22. Hofmanová, Z., Kreutzer, S., Hellenthal, G., Sell, C., Diekmann, Y., Dı́ez- ple and their genetic affinities. Genes (Basel) 10, 207. https://doi.org/10. Del-Molino, D., van Dorp, L., López, S., Kousathanas, A., Link, V., et al. 3390/genes10030207. (2016). Early farmers from across Europe directly descended from 6. Özbasxaran, M., Duru, G., and Stiner, M.C. (2018). The Early Settlement at Neolithic Aegeans. Proc. Natl. Acad. Sci. USA 113, 6886–6891. https:// Asxıklı Höyük: Essays in Honor of Ufuk Esin (Ege Yayınları). doi.org/10.1073/pnas.1523951113. 7. Stiner, M.C., Buitenhuis, H., Duru, G., Kuhn, S.L., Mentzer, S.M., Munro, 23. Mathieson, I., Lazaridis, I., Rohland, N., Mallick, S., Patterson, N., N.D., Pöllath, N., Quade, J., Tsartsidou, G., and Özbasxaran, M. (2014). A Roodenberg, S.A., Harney, E., Stewardson, K., Fernandes, D., Novak, forager-herder trade-off, from broad-spectrum hunting to sheep man- M., et al. (2015). Genome-wide patterns of selection in 230 ancient agement at As xıklı Höyük, Turkey. Proc. Natl. Acad. Sci. USA 111, Eurasians. Nature 528, 499–503. https://doi.org/10.1038/nature16152. 8404–8409. https://doi.org/10.1073/pnas.1322723111. 24. Alexander, D.H., Novembre, J., and Lange, K. (2009). Fast model-based 8. Abell, J.T., Quade, J., Duru, G., Mentzer, S.M., Stiner, M.C., Uzdurum, estimation of ancestry in unrelated individuals. Genome Res. 19, 1655– M., and Özbasxaran, M. (2019). Urine salts elucidate Early Neolithic animal 1664. https://doi.org/10.1101/gr.094052.109. management at Asxikli Höyük, Turkey. Sci. Adv. 5, eaaw0038. https://doi. 25. Patterson, N., Moorjani, P., Luo, Y., Mallick, S., Rohland, N., Zhan, Y., org/10.1126/sciadv.aaw0038. Genschoreck, T., Webster, T., and Reich, D. (2012). Ancient admixture Current Biology 31, 1–14, June 7, 2021 9 Please cite this article in press as: Yaka et al., Variable kinship patterns in Neolithic Anatolia revealed by ancient genomes, Current Biology (2021), https://doi.org/10.1016/j.cub.2021.03.050 ll Report in human history. Genetics 192, 1065–1093. https://doi.org/10.1534/ge- 44. Hodder, I. (2016). More on history houses at Çatalhöyük: A response to netics.112.145037. Carleton et al. J. Archaeol. Sci. 67, 1–6. https://doi.org/10.1016/j.jas. 26. Kılınç, G.M., Koptekin, D., Atakuman, Ç., Sümer, A.P., Dönertasx, H.M., 2015.10.010. Yaka, R., Bilgin, C.C., Büyükkarakaya, A.M., Baird, D., Altınısxık, E., 45. Sánchez-Quinto, F., Malmström, H., Fraser, M., Girdland-Flink, L., et al. (2017). Archaeogenomic analysis of the first steps of Svensson, E.M., Simões, L.G., George, R., Hollfelder, N., Burenhult, G., Neolithization in Anatolia and the Aegean. Proc. Biol. Sci. 284, Noble, G., et al. (2019). Megalithic tombs in western and northern 20172064. https://doi.org/10.1098/rspb.2017.2064. Neolithic Europe were linked to a kindred society. Proc. Natl. Acad. 27. Byrd, B.F. (1994). Public and Private, Domestic and Corporate: The Sci. USA 116, 9469–9474. https://doi.org/10.1073/pnas.1818037116. Emergence of the Southwest Asian Village. Am. Antiq. 59, 639–666. 46. Cassidy, L.M., Maoldúin, R.Ó., Kador, T., Lynch, A., Jones, C., https://doi.org/10.2307/282338. Woodman, P.C., Murphy, E., Ramsey, G., Dowd, M., Noonan, A., et al. 28. Mellaart, J. (1964). Excavations at Çatal Hüyük, 1963. Third Preliminary (2020). A dynastic elite in monumental Neolithic society. Nature 582, Report. Anatol. Stud. 14, 39–119. https://doi.org/10.2307/3642466. 384–388. https://doi.org/10.1038/s41586-020-2378-6. 29. Mellaart, J. (1967). Çatal Hüyük: a neolithic town in Anatolia (London 47. Bentley, R.A. (2013). Mobility and the diversity of Early Neolithic lives: Thames & Hudson). Isotopic evidence from skeletons. J. Anthropol. Archaeol. 32, 303–312. 30. Flannery, K.V. (2002). The Origins of the Village Revisited: From Nuclear https://doi.org/10.1016/j.jaa.2012.01.009. to Extended Households. Am. Antiq. 67, 417–433. https://doi.org/10. 48. Mittnik, A., Massy, K., Knipper, C., Wittenborn, F., Friedrich, R., Pfrengle, 2307/1593820. €ngler, A., et al. (2019). S., Burri, M., Carlichi-Witjes, N., Deeg, H., Furtwa 31. Atakuman, Ç. (2014). Architectural Discourse and Social Transformation Kinship-based social inequality in Bronze Age Europe. Science 366, During the Early Neolithic of Southeast Anatolia. J. World Prehist. 27, 731–734. https://doi.org/10.1126/science.aax6219. 1–42. https://doi.org/10.1007/s10963-014-9070-4. 49. Hansen, C.W., Jensen, P.S., and Skovsgaard, C.V. (2015). Modern 32. Düring, B.S., and Marciniak, A. (2005). Households and communities in gender roles and agricultural history: the Neolithic inheritance. J. Econ. the central Anatolian Neolithic. Archaeol. Dialogues 12, 165–187. Growth 20, 365–404. https://doi.org/10.1007/s10887-015-9119-y. https://doi.org/10.1017/S138020380600170X. 50. Wilk, R.R., and Rathje, W.L. (1982). Household Archaeology. Am. Behav. 33. Pearson, J.A., Bogaard, A., Charles, M., Hillson, S.W., Larsen, C.S., Sci. 25, 617–639. Russell, N., and Twiss, K. (2015). Stable carbon and nitrogen isotope vi-Strauss, C. (1991). Dictionnaire de l’ethnologie et de l’anthropologie, 51. Le analysis at Neolithic Çatalhöyük: Evidence for human and animal diet P. Bonte, and M. Izard, eds. (Presses Universitaires de France). and their relationship to households. J. Archaeol. Sci. 57, 69–79. https://doi.org/10.1016/j.jas.2015.01.007. 52. Hendon, J.A. (1996). Archaeological Approaches to the Organization of Domestic Labor: Household Practice and Domestic Relations. Annu. 34. Pearson, J., Lamb, A., and Evans, J. (2021). Multi-isotope Evidence of Rev. Anthropol. 25, 45–61. https://doi.org/10.1146/annurev.anthro.25. Diet (Carbon and Nitrogen) and Mobility (Strontium) at Neolithic 1.45. Çatalhöyük. In Excavations at Çatalhöyük, Volume 13, I. Hodder, ed. (British Institute at Ankara). 53. Bloch, M.E.F. (1998). How we think they think: anthropological ap- proaches to cognition, memory and literacy (Oxford: Westview Press). 35. Hanghøj, K., Moltke, I., Andersen, P.A., Manica, A., and Korneliussen, T.S. (2019). Fast and accurate relatedness estimation from high- vi-Strauss 54. Carsten, J., and Hugh-Jones, S. (1995). About the house: Le throughput sequencing data in the presence of inbreeding. and beyond, J. Carsten, and S. Hugh-Jones, eds. (Cambridge Gigascience 8, 1–9. https://doi.org/10.1093/gigascience/giz034. University Press). 36. Lipatov, M., Sanjeev, K., Patro, R., and Veeramah, K.R. (2015). Maximum 55. Gell, A. (1998). Art and agency: an anthropological theory (Clarendon Likelihood Estimation of Biological Relatedness from Low Coverage Press). Sequencing Data. bioRxiv, 1–20. https://doi.org/10.1101/023374. 56. Flannery, K.V. (1972). The Cultural Evolution of Civilizations. Annu. Rev. 37. Monroy Kuhn, J.M., Jakobsson, M., and Günther, T. (2018). Estimating Ecol. Syst. 3, 399–426. https://doi.org/10.1146/annurev.es.03.110172. genetic kin relationships in prehistoric populations. PLoS ONE 13, 002151. e0195491. https://doi.org/10.1371/journal.pone.0195491. 57. Steadman, S.R. (2004). Heading home: The architecture of family and so- 38. Byrd, B.F. (2000). Households in transition: Neolithic social organization ciety in early sedentary communities on the Anatolian Plateau. within Southwest Asia. In Life in Neolithic farming communities: social or- J. Anthropol. Res. 60, 515–558. https://doi.org/10.1086/jar.60.4. ganization, identity, and differentiation, I. Kuijt, ed. (Kluwer Academic 3631140. Publishers), pp. 63–98. 58. Banning, E.B. (2003). Housing Neolithic farmers. Near East. Archaeol. 66, 39. Haddow, S.D., and Knüsel, C.J. (2017). Skull Retrieval and Secondary 4–21. https://doi.org/10.2307/3210928. Burial Practices in the Neolithic Near East: Recent Insights from 59. Bar-Yosef, O. (2001). From Sedentary Foragers to Village Hierarchies: Çatalhöyük, Turkey. Bioarchaeology Int. 1, 52–71. https://doi.org/10. The Emergence of Social Institutions. Proc. Br. Acad. 110, 1–38. 5744/bi.2017.1002. https://doi.org/10.1186/2045-3701-4-49. 40. Haddow, S.D., Schotsmans, E.M.J., Milella, M., Pilloud, M.A., Tibbetts, B., and Knüsel, C.J. (2020). From Parts to a Whole? Exploring Changes 60. Goring-Morris, A.N., and Belfer-Cohen, A. (2008). A Roof Over One’s in Funerary Practices at Çatalhöyük. In Consciousness, Creativity, and Head: Developments in Near Eastern Residential Architecture Across Self at the Dawn of Settled Life, I. Hodder, ed. (Cambridge University the Epipalaeolithic-Neolithic Transition. In The Neolithic Demographic Press), pp. 250–272. https://doi.org/10.1017/9781108753616.016. Transition and its Consequences, J.P. Bocquet-Appel, and O. Bar- Yosef, eds. (Springer), pp. 239–286. https://doi.org/10.1007/978-1- 41. Pilloud, M.A. (2009). Community Structure at Neolithic Çatalhöyük : 4020-8539-0_10. Biological Distance Analysis of Household (Neighborhood, and Settlement). 61. Watkins, T. (2008). Supra-regional networks in the Neolithic of Southwest Asia. J. World Prehist. 21, 139–171. https://doi.org/10.1007/s10963- 42. Hodder, I. (2014). Çatalhöyük: The leopard changes its spots. A summary 008-9013-z. of recent work. Anatol. Stud. 64, 1–22. https://doi.org/10.1017/ S0066154614000027. 62. Hodder, I. (2006). The Leopard’s Tale: Revealing the Mysteries of 43. Mills, B.J. (2014). Relational Networks and Religious Sodalities at Çatalhöyük (Thames &Hudson). Çatalhöyük. In Religion at Work in a Neolithic Society: Vital Matters by 63. Mellaart, J. (1970). Excavations at HacilarVolume I-II (The British Institute Ian Hodder, I. Hodder, ed. (Cambridge University Press), pp. 159–186. of Archaeology at Ankara). 10 Current Biology 31, 1–14, June 7, 2021 Please cite this article in press as: Yaka et al., Variable kinship patterns in Neolithic Anatolia revealed by ancient genomes, Current Biology (2021), https://doi.org/10.1016/j.cub.2021.03.050 ll Report 64. Roodenberg, J., Van As, A., Jacobs, L., and Wijnen, M.H. (2003). Early riode byzantine, D. Beyer, O. Henry, and A. Tibet, eds. (3èmes à la pe settlement in the plain of Yenisxehir (NW Anatolia). Anatolica 29, 17–59. Recontres d’arche ologie de l’IFÉA), pp. 43–51. https://doi.org/10.2143/ANA.29.0.2015511. 82. Stiner, M.C., Bailey, K.S., Christidou, R., and Munro, N.D. (2018). Spatial 65. Marciniak, A. (2016). The Late Neolithic Transition: The Case of and Zooarchaeological Evidence of Human-Animal Interactions in the Çatalhöyük East. In The Origins of Food Production, N. Sanz, ed. Early PPN Settlement at Asxıklı Höyük. In The Early Settlement at Asxıklı (UNESCO), pp. 78–89. Höyük: Essays in Honor of Ufuk Esin, M. Özbasxaran, G. Duru, and M.C. 66. Kuijt, I., Guerrero, E., Molist, M., and Anfruns, J. (2011). The changing Stiner, eds. (Ege Yayınları), pp. 219–259. Neolithic household: Household autonomy and social segmentation, 83. Buitenhuis, H., Peters, J., Pöllath, N., Stiner, M.C., Munro, N.D., and Tell Halula, Syria. J. Anthropol. Archaeol. 30, 502–522. https://doi.org/ Sarıtasx, Ö. (2018). The Faunal Remains from Levels 3 and 2 of As xıklı 10.1016/j.jaa.2011.07.001. Höyük: Evidence for Emerging Management Practices. In The Early 67. Özbasxaran, M. (2012). Asxıklı. The Neolithic in Turkey (Arkeoloji Sanat Settlement at Asxıklı Höyük: Essays in Honor of Ufuk Esin, M. Yayınları), pp. 135–158. Özbasxaran, G. Duru, and M.C. Stiner, eds. (Ege Yayınları). 84. Peters, J., Neuberger, F., Wiechmann, I., Zimmermann, M., Balasse, M., 68. Düring, B. (2006). Constructing communities: clustered neighbourhood and Pöllath, N. (2018). Shaping the Sheep: Human Management and settlements of the Central Anatolian Neolithic CA. 8500-5500 Cal. BC. Decision-making at As xıklı Höyük, Central Anatolia. In The Early (Peeters Publishers). Settlement at Asxıklı Höyük: Essays in Honor of Ufuk Esin, M. 69. Bienert, H.-D., Gebel, H.G.K., and Neef, R. (2004). Central Settlements in Özbasxaran, G. Duru, and M.C. Stiner, eds. (Ege Yayınları), pp. 325–345. Neolithic Jordan (Ex Oriente). 85. Erdal, Ö.D. (2018). Lifestyle and Health Conditions of the Neolithic People 70. Duru, G. (2018). Sedentism and Solitude: Exploring the impact of private of Asxıklı Höyük. In The Early Settlement at Asxıklı Höyük: Essays in Honor space on social cohesion in the Neolithic. Religion, History, and Place in of Ufuk Esin., M.C. Özbasxaran, G. Duru, and M. Stiner, eds. (Ege the Origin of Settled Life (University Press of Colorado). https://doi.org/ Yayınları), pp. 405–423. 10.5876/9781607327370.c006. 86. Baird, D. (2012). The Late Epipaleolithic, Neolithic, and Chalcolithic of the 71. Matthews, R., Matthews, W., Richardson, A., Raheem, K.R., Walsh, S., Anatolian Plateau, 13,000-4000 BC. In A Companion to the Archaeology Aziz, K.R., Bendrey, R., Whitlam, J.M.C., Bogaard, A., et al. (2019). The of the Ancient Near East, D.T. Potts, ed. (Wiley), pp. 431–465. https://doi. early Neolithic of Iraqi Kurdistan: current research at Bestansur, org/10.1002/9781444360790.ch23. orient 45, 13–32. Shahrizor Plain. Pae 87. Baird, D., Fairbairn, A., Martin, L., and Middleton, C. (2012). The Boncuklu 72. Einwögerer, T., Friesinger, H., Ha€ndel, M., Neugebauer-Maresch, C., project: the origins of sedentism, cultivation and herding in central Simon, U., and Teschler-Nicola, M. (2006). Upper Palaeolithic infant Anatolia (Archaeology and Art Publications). burials. Nature 444, 285. https://doi.org/10.1038/444285a. 88. Byrd, B.F. (2005). Reassessing the emergence of village life in the Near 73. Castex, D., and Kacki, S. (2016). Demographic Patterns Distinctive East. J. Archaeol. Res. 13, 231–290. https://doi.org/10.1007/s10814- of Epidemic Cemeteries in Archaeological Samples. Paleomicrobiology 005-3107-2. of Humans (ASM Press), pp. 1–11. https://doi.org/10.1128/ 89. Orton, D., Anvari, J., Gibson, C., Last, J., Bogaard, A., Rosenstock, E., 9781555819170.ch1. and Biehl, P.F. (2018). A tale of two tells: dating the Çatalhöyük West 74. Haddow, S.D., Sadvari, J.W., Knüsel, C.J., and Hadad, R. (2016). A Tale Mound. Antiquity 92, 620–639. https://doi.org/10.15184/aqy.2018.91. of Two Platforms: Commingled Remains and the Life-Course of Houses 90. Hodder, I., and Cessford, C. (2004). Daily Practice and Social Memory at at Neolithic Çatalhöyük. Theoretical Approaches to Analysis and Çatalhöyük. Am. Antiq. 69, 17–40. https://doi.org/10.2307/4128346. Interpretation of Commingled Human Remains (Springer International Publishing), pp. 5–29. https://doi.org/10.1007/978-3-319-22554-8_2. 91. Bogaard, A., Fraser, R., Heaton, T.H.E., Wallace, M., Vaiglova, P., Charles, M., Jones, G., Evershed, R.P., Styring, A.K., Andersen, N.H., 75. Kuijt, I. (2002). Keeping the Peace. Life in Neolithic Farming Communities et al. (2013). Crop manuring and intensive land management by (Springer), pp. 137–164. https://doi.org/10.1007/0-306-47166-3_6. Europe’s first farmers. Proc. Natl. Acad. Sci. USA 110, 12589–12594. 76. Nadel, D., Danin, A., Power, R.C., Rosen, A.M., Bocquentin, F., Tsatskin, https://doi.org/10.1073/pnas.1305918110. A., Rosenberg, D., Yeshurun, R., Weissbrod, L., Rebollo, N.R., et al. 92. Russell, N., Twiss, K.C., Orton, D.C., and Demirergi, G.A. (2013). More on (2013). Earliest floral grave lining from 13,700-11,700-y-old Natufian the Çatalhöyük mammal remains. In Humans and Landscapes of burials at Raqefet Cave, Mt. Carmel, Israel. Proc. Natl. Acad. Sci. USA Çatalhöyük: Reports from the 2000-2008 Seasons, I. Hodder, ed. 110, 11774–11778. https://doi.org/10.1073/pnas.1302277110. (British Institute at Ankara; Los Angeles: Cotsen Institute of 77. Littleton, J., and Allen, H. (2007). Hunter-gatherer burials and the creation Archaeology Press), pp. 213–258. of persistent places in southeastern Australia. J. Anthropol. Archaeol. 26, , D., Kabukcu, C., 93. Wolfhagen, J., Veropoulidou, R., Ayala, G., Filipovic 283–298. https://doi.org/10.1016/j.jaa.2006.11.004. Lancelotti, C., Madella, M., Paw1owska, K., Santiago-Marrero, C.G., 78. Alt, K.W., Benz, M., Müller, W., Berner, M.E., Schultz, M., Schmidt- and Wainwright, J. (2020). The seasonality of wetland and riparian task- Schultz, T.H., Knipper, C., Gebel, H.-G.G.K., Nissen, H.J., and Vach, scapes at Çatalhöyük. Near East. Archaeol. 83, 98–109. https://doi.org/ W. (2013). Earliest evidence for social endogamy in the 9,000-year-old- 10.1086/708446. population of Basta, Jordan. PLoS ONE 8, e65649. https://doi.org/10. 94. Boz, B., Hager, L.D., and Haddow, S.D. (2006). Human Remains. 1371/journal.pone.0065649. Çatalhöyük Archive Report 2006. 79. Alt, K.W., Benz, M., Vach, W., Simmons, T.L., and Goring-Morris, A.N. 95. Anvari, J., Brady, J., Franz, I., Naumov, G., Orton, D., Ostaptchouk, S., (2015). Insights into the social structure of the PPNB Site of Kfar Stroud, E., Willet, P., Rosenstock, E., and Biehl, P.F. (2017). HaHoresh, Israel, based on dental remains. PLoS ONE 10, e0134528. Continuous Change: Venturing into the Early Chalcolithic at Çatalhöyük https://doi.org/10.1371/journal.pone.0134528. in the Archaeology of Anatolia, S. Steadman, and G. McMahon, eds. 80. Larsen, C.S., Hillson, S.W., Boz, B., Pilloud, M.A., Sadvari, J.W., Agarwal, (Cambridge Scholars Publishing). S.C., Glencross, B., Beauchesne, P., Pearson, J., Ruff, C.B., et al. (2015). 96. Biehl, P.F. (2012). The transition of the megasite Çatalhöyük in the Late Bioarchaeology of Neolithic Çatalhöyük: Lives and Lifestyles of an Early Neolithic and Early Chalcolithic. In Proceedings of the 7th International Farming Society in Transition. J. World Prehist. 28, 27–68. https://doi. Congress on the Archaeology of the Ancient Near East. Volume I: org/10.1007/s10963-015-9084-6. Mega-Cities and Mega-Sites. The Archaeology of Consumption and 81. Özbasxaran, M., and Duru, G. (2015). The Early Sedentary Community of Disposal, Landscape, Transport and Communication, R. Matthews, Cappadocia: As ridionale de la pre xıklı Höyük. In La Cappadoce Me histoire and J. Curtis, eds., pp. 17–34. Current Biology 31, 1–14, June 7, 2021 11 Please cite this article in press as: Yaka et al., Variable kinship patterns in Neolithic Anatolia revealed by ancient genomes, Current Biology (2021), https://doi.org/10.1016/j.cub.2021.03.050 ll Report 97. Knüsel, C.J., Milella, M., Betz, B., Dori, I., Garofalo, E., Glencross, B., 113. Brown, T.A., Nelson, D.E., Vogel, J.S., and Southon, J.R. (1988). Improved Haddow, S.D., Ledger, M., Anastasiou, E., Mitchell, P., et al. Collagen Extraction by Modified Longin Method. Radiocarbon 30, Bioarchaeology at Neolithic Çatalhöyük: indicators of health, well-being 171–177. https://doi.org/10.1017/s0033822200044118. and lifeway in their social context. In Peopling the Landscape of mec, M., and Bourquin, J. (2010). A revolutionary graphi- 114. Wacker, L., Ne Çatalhöyük: Reports from the 2009-2017 Seasons. Çatalhöyük tisation system: Fully automated, compact and simple. Nucleic Research Project Series, Volume 13, I. Hodder, ed. (British Institute at Instruments Methods Phys. Res. Sect. B Beam Interact. with Mater. Ankara). Atoms 268, 931–934. https://doi.org/10.1016/j.nimb.2009.10.067. 98. Groenhuijzen, M.R., Kluiving, S.J., Gerritsen, F.A., and Künzel, M. (2015). 115. Brock, F.C., Higham, T.F.G., Ditchfield, P., and Ramsey, C.B. (2010). Geoarchaeological research at Barcin Höyük: Implications for the initial Current pretreatment methods for AMS radiocarbon dating at the Neolithic occupation of northwest Anatolia. Quat. Int. 367, 51–61. Oxford Radiocarbon Accelerator Unit (ORAU). Radiocarbon 52, https://doi.org/10.1016/j.quaint.2014.11.014. 103–112. https://doi.org/10.1017/S0033822200045069. 99. Gerritsen, F.A., Özbal, R.D., and Thissen, L. (2013). ). Barcın Höyük. The 116. Dee, M.D., and Bronk Ramsey, C. (2000). Refinement of graphite target Beginnings of Farming in the Marmara Region. In The Neolithic in Turkey. production at ORAU. Nucleic Instruments Methods Phys. Res. Sect. B New Excavations and New Research. Vol. 5 Northwestern Turkey and Beam Interact. with Mater. Atoms 172, 449–453. https://doi.org/10. Istanbul, M. Özdog an, N. Basgelen, and P. Kuniholm, eds. (Art and 1016/S0168-583X(00)00337-2. Archaeology Publications), pp. 93–112. 117. Bronk Ramsey, C., Higham, T., and Leach, P. (2004). Towards High- 100. Gerritsen, F.A., Özbal, R., and Thissen, L.C. (2013). The earliest neolithic Precision AMS: Progress and Limitations. Radiocarbon 46, 17–24. levels at Barcin Höyük, Northwestern Turkey. Anatolica 39, 53–92. https://doi.org/10.1017/s0033822200039308. https://doi.org/10.2143/ANA.39.0.2990784. 118. Beaumont, W., Beverly, R., Southon, J., and Taylor, R.E. (2010). Bone 101. Balcı, H., Cappers, R.T., Gerritsen, F.A., and Özbal, R.D. (2019). Barcın preparation at the KCCAMS laboratory. Nucleic Instruments Methods Höyük’te bitki seçimi: 2013–2015 yılı arkeo-botanik sonuçlarının deger- Phys. Res. Sect. B Beam Interact. with Mater. Atoms 268, 906–909. lendirilmesi. https://doi.org/10.1016/j.nimb.2009.10.061. 102. Galik, A. (2013). Barçın Höyük Zooarchaeology. https://doi.org/10.6078/ 119. Santos, G.M., Moore, R.D., Southon, J.R., Griffin, S., Hinger, E., and M78G8HM0. http://opencontext.org/projects/74749949-4FD4-4C3E- Zhang, D. (2007). AMS 14C sample preparation at the KCCAMS/UCI fa- C830-5AA75703E08E. cility: Status report and performance of small samples. Radiocarbon 49, 103. Würtenberger, D. (2012). Archa€ozoologische analysen am fundmaterial 255–269. https://doi.org/10.1017/S0033822200042181. des Barcın Höyüks im vergleich mit aus- gewa€hlten fundstellen des 7. 120. Xu, X.M., Trumbore, S.E., Zheng, S.H., Southon, J.R., McDuffee, K.E., und 6. Jt. v. Chr. in Nord- west- und Westanatolien. Luttgen, M., and Liu, J.C. (2007). Modifying a sealed tube zinc reduction 104. Özbal, H., Thissen, L., Dog an, T., Gerritsen, F.A., Özbal, R.D., and method for preparation of AMS graphite targets: Reducing background Türkekul Bıyık, A. (2013). Neolitik Batı Anadolu ve Marmara Yerlesximleri and attaining high precision. Nucleic Instruments Methods Phys. Res. Çanak Çömleklerinde Organik Kalıntı Analizleri. In Arkeometri Sonuçları Sect. B Beam Interact. with Mater. Atoms 259, 320–329. https://doi. Toplantısı, H. Dönmez, and Ö. Ötgün, eds. (Antiquity and Archeology, org/10.1016/j.nimb.2007.01.175. Art and Culture, History, Antiquity, CLUE+), pp. 105–114. 121. Southon, J.R., Santos, G.M., Druffel, E.R., Griffin, S., Trumbore, S., and 105. Evershed, R.P., Payne, S., Sherratt, A.G., Copley, M.S., Coolidge, J., Xu, X. (2005). High throughput, high precision 14C AMS with a small Urem-Kotsu, D., Kotsakis, K., Ozdog an, M., Ozdog an, A.E., accelerator. International Atomic Energy Agency Symposium on Nieuwenhuyse, O., et al. (2008). Earliest date for milk use in the Near Utilisation of Accelerators, IAEA-CN-115-10. East and southeastern Europe linked to cattle herding. Nature 455, 122. Longin, R. (1971). New method of collagen extraction for radiocarbon 528–531. https://doi.org/10.1038/nature07180. dating. Nature 230, 241–242. https://doi.org/10.1038/230241a0. 106. Thissen, L., Ӧzbal, H., Biyik, A.T., Gerritsen, F., and Ӧzbal, R. (2010). The 123. Vogel, J.S., Southon, J.R., Nelson, D.E., and Brown, T.A. (1984). Land of Milk? Approaching Dietary Preferences of Late Neolithic Performance of catalytically condensed carbon for use in accelerator Communities in NW Anatolia. Leiden J. Pottery Stud. 26, 157–172. mass spectrometry. Nucl. Instrum. Methods Phys. Res. B 5, 289–293. 107. de Groot, B., Thissen, L., Özbal, R., and Gerritsen, F. (2017). Clay prep- https://doi.org/10.1016/0168-583X(84)90529-9. aration and function of the first ceramics in north-west Anatolia: A case 124. Salehpour, M., Håkansson, K., Possnert, G., Wacker, L., and Synal, H.A. study from Neolithic Barcın Höyük. J. Archaeol. Sci. Reports 16, (2016). Performance report for the low energy compact radiocarbon 542–552. https://doi.org/10.1016/j.jasrep.2017.06.028. accelerator mass spectrometer at Uppsala University. Nucleic 108. Lazaridis, I., Nadel, D., Rollefson, G., Merrett, D.C., Rohland, N., Mallick, Instruments Methods Phys. Res. Sect. B Beam Interact. with Mater. S., Fernandes, D., Novak, M., Gamarra, B., Sirak, K., et al. (2016). Atoms 371, 360–364. https://doi.org/10.1016/j.nimb.2015.10.034. Genomic insights into the origin of farming in the ancient Near East. 125. Stuiver, M.J., and Polach, H.A. (1977). Reporting of 14C data. Nature 536, 419–424. https://doi.org/10.1038/nature19310. Radiocarbon 19, 355–363. 109. Alpaslan Roodenberg, M.S., Gerritsen, F.A., and Özbal, R. (2013). 126. Ward, G.K., and Wilson, S.R. (1978). Procedures for Comparing and Neolithic burials from Barcin Höyük: The 2007-2012 excavation seasons. Combining Radiocarbon Age Determinations: A Critique. Archaeometry Anatolica 39, 93–111. https://doi.org/10.2143/ANA.39.0.2990785. 20, 19–31. https://doi.org/10.1111/j.1475-4754.1978.tb00208.x. 110. Büyükkarakaya, A.M., Çakan, Y.G., Godon, M., Erdal, Y.S., and Bıçakçı, 127. Reimer, P.J., Austin, W.E.N., Bard, E., Bayliss, A., Blackwell, P., Bronk E. (2019). Handling dead bodies: Investigating the formation process of a Ramsey, C., Butzin, M., Cheng, H., Edwards, R.L., Friedrich, M., et al. collective burial from Neolithic Tepecik-Çiftlik, Central Anatolia (Turkey). (2020). The IntCal20 Northern Hemisphere radiocarbon age calibration J. Anthropol. Archaeol. 56, 101118. https://doi.org/10.1016/j.jaa.2019. curve (0-55 kcal BP). Radiocarbon 62, https://doi.org/10.1017/RDC. 101118. 2020.41. 111. Buikstra, J.E., and Ubelaker, D.H. (1994). Standards for Data Collection 128. Stuiver, M., and Reimer, P.J. (1993). Extended 14C data base and revised from Human Skeletal Remains : Proceedings of a Seminar at the Field CALIB 3.0 14C age calibration program. Radiocarbon 35, 215–230. Museum of Natural History, J.E. Buikstra, ed. (Arkansas Archeological https://doi.org/10.1017/S0033822200013904. Survey). 129. Yaka, R., Birand, A., Yılmaz, Y., Caner, C., Açan, S.C., Gündüzalp, S., 112. Özbasxaran, M., Duru, G., and Uzdurum, M. (2018). Architecture of the Parvizi, P., Erim Özdog an, A., Togan, _I., and Somel, M. (2018). Early Settlement and Trends through the Cultural Sequence. The Early Archaeogenetics of Late Iron Age Çemialo Sırtı, Batman: Investigating Settlement at Asxıklı Höyük (Ege Yayınları). maternal genetic continuity in north Mesopotamia since the Neolithic. 12 Current Biology 31, 1–14, June 7, 2021 Please cite this article in press as: Yaka et al., Variable kinship patterns in Neolithic Anatolia revealed by ancient genomes, Current Biology (2021), https://doi.org/10.1016/j.cub.2021.03.050 ll Report Am. J. Phys. Anthropol. 166, 196–207. https://doi.org/10.1002/ajpa. 144. Rasmussen, M., Guo, X., Wang, Y., Lohmueller, K.E., Rasmussen, S., 23423. Albrechtsen, A., Skotte, L., Lindgreen, S., Metspalu, M., Jombart, T., 130. Dabney, J., Knapp, M., Glocke, I., Gansauge, M.T., Weihmann, A., et al. (2011). An Aboriginal Australian genome reveals separate human €a Nickel, B., Valdiosera, C., Garcı́a, N., Pa €bo, S., Arsuaga, J.L., and dispersals into Asia. Science 334, 94–98. https://doi.org/10.1126/sci- Meyer, M. (2013). Complete mitochondrial genome sequence of a ence.1211177. Middle Pleistocene cave bear reconstructed from ultrashort DNA frag- 145. Skoglund, P., Malmström, H., Raghavan, M., Storå, J., Hall, P., Willerslev, ments. Proc. Natl. Acad. Sci. USA 110, 15758–15763. https://doi.org/ E., Gilbert, M.T.P., Götherström, A., and Jakobsson, M. (2012). Origins 10.1073/pnas.1314445110. and genetic legacy of Neolithic farmers and hunter-gatherers in 131. Ottoni, C., Ricaut, F.X., Vanderheyden, N., Brucato, N., Waelkens, M., Europe. Science 336, 466–469. https://doi.org/10.1126/science. and Decorte, R. (2011). Mitochondrial analysis of a Byzantine population 1216304. reveals the differential impact of multiple historical events in South 146. Skoglund, P., Storå, J., Götherström, A., and Jakobsson, M. (2013). Anatolia. Eur. J. Hum. Genet. 19, 571–576. https://doi.org/10.1038/ Accurate sex identification of ancient human remains using DNA shotgun ejhg.2010.230. sequencing. J. Archaeol. Sci. 40, 4477–4482. https://doi.org/10.1016/j. jas.2013.07.004. 132. Yang, D.Y., Eng, B., Waye, J.S., Dudar, J.C., and Saunders, S.R. (1998). Technical note: improved DNA extraction from ancient bones using sil- 147. Kılınç, G.M., Kashuba, N., Yaka, R., Sümer, A.P., Yüncü, E., Shergin, D., ica-based spin columns. Am. J. Phys. Anthropol. 105, 539–543. https:// Ivanov, G.L., Kichigin, D., Pestereva, K., Volkov, D., et al. (2018). doi.org/10.1002/(SICI)1096-8644(199804)105:4<539:AID-AJPA10>3.0. Investigating Holocene human population history in North Asia using CO;2-1. ancient mitogenomes. Sci. Rep. 8, 8969. https://doi.org/10.1038/ s41598-018-27325-0. 133. Svensson, E.M., Anderung, C., Baubliene, J., Persson, P., Malmström, H., Smith, C., Vretemark, M., Daugnora, L., and Götherström, A. (2007). 148. Weissensteiner, H., Pacher, D., Kloss-Brandsta€tter, A., Forer, L., Specht, Tracing genetic change over time using nuclear SNPs in ancient and G., Bandelt, H.J., Kronenberg, F., Salas, A., and Schönherr, S. (2016). modern cattle. Anim. Genet. 38, 378–383. https://doi.org/10.1111/j. HaploGrep 2: mitochondrial haplogroup classification in the era of 1365-2052.2007.01620.x. high-throughput sequencing. Nucleic Acids Res. 44 (W1). W58-63. https://doi.org/10.1093/nar/gkw233. 134. Meyer, M., and Kircher, M. (2010). Illumina sequencing library prepara- tion for highly multiplexed target capture and sequencing. Cold Spring cse 149. Brandt, G., Haak, W., Adler, C.J., Roth, C., Sze nyi-Nagy, A., Karimnia, Harb. Protoc. 2010, t5448. https://doi.org/10.1101/pdb.prot5448. S., Möller-Rieker, S., Meller, H., Ganslmeier, R., Friederich, S., et al.; Genographic Consortium (2013). Ancient DNA reveals key stages in the 135. Günther, T., Valdiosera, C., Malmström, H., Ureña, I., Rodriguez-Varela, formation of central European mitochondrial genetic diversity. Science R., Sverrisdóttir, Ó.O., Daskalaki, E.A., Skoglund, P., Naidoo, T., 342, 257–261. https://doi.org/10.1126/science.1241844. Svensson, E.M., et al. (2015). Ancient genomes link early farmers from 150. Fernández, E., Pe rez-Pe rez, A., Gamba, C., Prats, E., Cuesta, P., Atapuerca in Spain to modern-day Basques. Proc. Natl. Acad. Sci. USA 112, 11917–11922. https://doi.org/10.1073/pnas.1509851112. Anfruns, J., Molist, M., Arroyo-Pardo, E., and Turbón, D. (2014). Ancient DNA analysis of 8000 B.C. near eastern farmers supports an 136. Kircher, M. (2012). Analysis of high-throughput ancient DNA sequencing early neolithic pioneer maritime colonization of Mainland Europe through data. Methods Mol. Biol. 840, 197–228. https://doi.org/10.1007/978-1- Cyprus and the Aegean Islands. PLoS Genet. 10, e1004401. https://doi. 61779-516-9_23. org/10.1371/journal.pgen.1004401. 137. Schubert, M., Lindgreen, S., and Orlando, L. (2016). AdapterRemoval v2: 151. Poznik, G.D., Xue, Y., Mendez, F.L., Willems, T.F., Massaia, A., Wilson rapid adapter trimming, identification, and read merging. BMC Res. Sayres, M.A., Ayub, Q., McCarthy, S.A., Narechania, A., Kashin, S., Notes 9, 88. https://doi.org/10.1186/s13104-016-1900-2. et al.; 1000 Genomes Project Consortium (2016). Punctuated bursts in 138. Li, H., and Durbin, R. (2009). Fast and accurate short read alignment with human male demography inferred from 1,244 worldwide Y-chromosome Burrows-Wheeler transform. Bioinformatics 25, 1754–1760. https://doi. sequences. Nat. Genet. 48, 593–599. https://doi.org/10.1038/ng.3559. org/10.1093/bioinformatics/btp324. 152. Auton, A., Brooks, L.D., Durbin, R.M., Garrison, E.P., Kang, H.M., Korbel, 139. Lazaridis, I., Patterson, N., Mittnik, A., Renaud, G., Mallick, S., Kirsanow, J.O., Marchini, J.L., McCarthy, S., McVean, G.A., and Abecasis, G.R.; K., Sudmant, P.H., Schraiber, J.G., Castellano, S., Lipson, M., et al. 1000 Genomes Project Consortium (2015). A global reference for human (2014). Ancient human genomes suggest three ancestral populations genetic variation. Nature 526, 68–74. https://doi.org/10.1038/na- for present-day Europeans. Nature 513, 409–413. https://doi.org/10. ture15393. 1038/nature13673. 153. Mallick, S., Li, H., Lipson, M., Mathieson, I., Gymrek, M., Racimo, F., €a 140. Skoglund, P., Northoff, B.H., Shunkov, M.V., Derevianko, A.P., Pa €bo, S., Zhao, M., Chennagiri, N., Nordenfelt, S., Tandon, A., et al. (2016). The Krause, J., and Jakobsson, M. (2014). Separating endogenous ancient Simons Genome Diversity Project: 300 genomes from 142 diverse pop- DNA from modern day contamination in a Siberian Neandertal. Proc. ulations. Nature 538, 201–206. https://doi.org/10.1038/nature18964. Natl. Acad. Sci. USA 111, 2229–2234. https://doi.org/10.1073/pnas. 154. Günther, T., Malmström, H., Svensson, E.M., Omrak, A., Sánchez- 1318934111. Quinto, F., Kılınç, G.M., Krzewinska, M., Eriksson, G., Fraser, M., 141. Skoglund, P., Malmström, H., Omrak, A., Raghavan, M., Valdiosera, C., Edlund, H., et al. (2018). Population genomics of Mesolithic Günther, T., Hall, P., Tambets, K., Parik, J., Sjögren, K.G., et al. (2014). Scandinavia: Investigating early postglacial migration routes and high- Genomic diversity and admixture differs for Stone-Age Scandinavian for- latitude adaptation. PLoS Biol. 16, e2003703. https://doi.org/10.1371/ agers and farmers. Science 344, 747–750. https://doi.org/10.1126/sci- journal.pbio.2003703. ence.1253448. 155. Patterson, N., Price, A.L., and Reich, D. (2006). Population structure and 142. Fu, Q., Mittnik, A., Johnson, P.L.F., Bos, K., Lari, M., Bollongino, R., Sun, eigenanalysis. PLoS Genet. 2, e190. https://doi.org/10.1371/journal. C., Giemsch, L., Schmitz, R., Burger, J., et al. (2013). A revised timescale pgen.0020190. for human evolution based on ancient mitochondrial genomes. Curr. Biol. 156. Purcell, S., Neale, B., Todd-Brown, K., Thomas, L., Ferreira, M.A.R., 23, 553–559. https://doi.org/10.1016/j.cub.2013.02.044. Bender, D., Maller, J., Sklar, P., de Bakker, P.I.W., Daly, M.J., and 143. Li, H., Handsaker, B., Wysoker, A., Fennell, T., Ruan, J., Homer, N., Sham, P.C. (2007). PLINK: a tool set for whole-genome association Marth, G., Abecasis, G., and Durbin, R.; 1000 Genome Project Data and population-based linkage analyses. Am. J. Hum. Genet. 81, Processing Subgroup (2009). The Sequence Alignment/Map format 559–575. https://doi.org/10.1086/519795. and SAMtools. Bioinformatics 25, 2078–2079. https://doi.org/10.1093/ 157. Behr, A.A., Liu, K.Z., Liu-Fang, G., Nakka, P., and Ramachandran, S. bioinformatics/btp352. (2016). pong: fast analysis and visualization of latent clusters in Current Biology 31, 1–14, June 7, 2021 13 Please cite this article in press as: Yaka et al., Variable kinship patterns in Neolithic Anatolia revealed by ancient genomes, Current Biology (2021), https://doi.org/10.1016/j.cub.2021.03.050 ll Report population genetic data. Bioinformatics 32, 2817–2823. https://doi.org/ 168. Jones, B.L., Raga, T.O., Liebert, A., Zmarz, P., Bekele, E., Danielsen, 10.1093/bioinformatics/btw327. E.T., Olsen, A.K., Bradman, N., Troelsen, J.T., and Swallow, D.M. 158. Harney, É., Patterson, N., Reich, D., and Wakeley, J. (2020). Assessing (2013). Diversity of lactase persistence alleles in Ethiopia: signature of the Performance of qpAdm: A Statistical Tool for Studying Population a soft selective sweep. Am. J. Hum. Genet. 93, 538–544. https://doi. Admixture. bioRxiv. 2020.04.09.032664. https://doi.org/10.1101/2020. org/10.1016/j.ajhg.2013.07.008. 04.09.032664. 169. Ranciaro, A., Campbell, M.C., Hirbo, J.B., Ko, W.Y., Froment, A., 159. Prüfer, K., Racimo, F., Patterson, N., Jay, F., Sankararaman, S., Sawyer, Anagnostou, P., Kotze, M.J., Ibrahim, M., Nyambo, T., Omar, S.A., and S., Heinze, A., Renaud, G., Sudmant, P.H., de Filippo, C., et al. (2014). Tishkoff, S.A. (2014). Genetic origins of lactase persistence and the The complete genome sequence of a Neanderthal from the Altai spread of pastoralism in Africa. Am. J. Hum. Genet. 94, 496–510. Mountains. Nature 505, 43–49. https://doi.org/10.1038/nature12886. https://doi.org/10.1016/j.ajhg.2014.02.009. 160. Meyer, M., Kircher, M., Gansauge, M.T., Li, H., Racimo, F., Mallick, S., 170. Allentoft, M.E., Sikora, M., Sjögren, K.G., Rasmussen, S., Rasmussen, Schraiber, J.G., Jay, F., Prüfer, K., de Filippo, C., et al. (2012). A high- M., Stenderup, J., Damgaard, P.B., Schroeder, H., Ahlström, T., Vinner, coverage genome sequence from an archaic Denisovan individual. L., et al. (2015). Population genomics of Bronze Age Eurasia. Nature Science 338, 222–226. https://doi.org/10.1126/science.1224344. 522, 167–172. https://doi.org/10.1038/nature14507. 161. Skoglund, P., Mallick, S., Bortolini, M.C., Chennagiri, N., Hünemeier, T., 171. McQuillan, R., Leutenegger, A.L., Abdel-Rahman, R., Franklin, C.S., Petzl-Erler, M.L., Salzano, F.M., Patterson, N., and Reich, D. (2015). Pericic, M., Barac-Lauc, L., Smolej-Narancic, N., Janicijevic, B., Genetic evidence for two founding populations of the Americas. Nature Polasek, O., Tenesa, A., et al. (2008). Runs of homozygosity in 525, 104–108. https://doi.org/10.1038/nature14895. European populations. Am. J. Hum. Genet. 83, 359–372. https://doi. 162. Fu, Q., Posth, C., Hajdinjak, M., Petr, M., Mallick, S., Fernandes, D., org/10.1016/j.ajhg.2008.08.007. Furtwa€ngler, A., Haak, W., Meyer, M., Mittnik, A., et al. (2016). The ge- 172. Keller, M.C., Visscher, P.M., and Goddard, M.E. (2011). Quantification of netic history of Ice Age Europe. Nature 534, 200–205. https://doi.org/ inbreeding due to distant ancestors and its detection using dense single 10.1038/nature17993. nucleotide polymorphism data. Genetics 189, 237–249. https://doi.org/ 163. Jones, E.R., Gonzalez-Fortes, G., Connell, S., Siska, V., Eriksson, A., 10.1534/genetics.111.130922. Martiniano, R., McLaughlin, R.L., Gallego Llorente, M., Cassidy, L.M., 173. Bherer, C., Campbell, C.L., and Auton, A. (2017). Refined genetic maps Gamba, C., et al. (2015). Upper Palaeolithic genomes reveal deep roots reveal sexual dimorphism in human meiotic recombination at multiple of modern Eurasians. Nat. Commun. 6, 8912. https://doi.org/10.1038/ scales. Nat. Commun. 8, 14994. https://doi.org/10.1038/ncomms14994. ncomms9912. 174. Kent, W.J., Sugnet, C.W., Furey, T.S., Roskin, K.M., Pringle, T.H., Zahler, cse 164. Mathieson, I., Alpaslan-Roodenberg, S., Posth, C., Sze nyi-Nagy, A., A.M., and Haussler, D. (2002). The human genome browser at UCSC. Rohland, N., Mallick, S., Olalde, I., Broomandkhoshbacht, N., Candilio, Genome Res. 12, 996–1006. https://doi.org/10.1101/gr.229102. F., Cheronet, O., et al. (2018). The genomic history of southeastern 175. Caballero, M., Seidman, D.N., Qiao, Y., Sannerud, J., Dyer, T.D., Europe. Nature 555, 197–203. https://doi.org/10.1038/nature25778. Lehman, D.M., Curran, J.E., Duggirala, R., Blangero, J., Carmi, S., and 165. Haak, W., Lazaridis, I., Patterson, N., Rohland, N., Mallick, S., Llamas, B., Williams, A.L. (2019). Crossover interference and sex-specific genetic Brandt, G., Nordenfelt, S., Harney, E., Stewardson, K., et al. (2015). maps shape identical by descent sharing in close relatives. PLoS Massive migration from the steppe was a source for Indo-European lan- Genet. 15, e1007979. https://doi.org/10.1371/journal.pgen.1007979. guages in Europe. Nature 522, 207–211. https://doi.org/10.1038/na- 176. Van Rossum, G. (1995). Python tutorial. Technical Report CS-R9526. ture14317. 166. van de Loosdrecht, M., Bouzouggar, A., Humphrey, L., Posth, C., Barton, 177. Housworth, E.A., and Stahl, F.W. (2003). Crossover interference in hu- N., Aximu-Petri, A., Nickel, B., Nagel, S., Talbi, E.H., El Hajraoui, M.A., mans. Am. J. Hum. Genet. 73, 188–197. https://doi.org/10.1086/376610. et al. (2018). Pleistocene North African genomes link Near Eastern and 178. Campbell, C.L., Furlotte, N.A., Eriksson, N., Hinds, D., and Auton, A. sub-Saharan African human populations. Science 360, 548–552. (2015). Escape from crossover interference increases with maternal https://doi.org/10.1126/science.aar8380. age. Nat. Commun. 6, 6260. https://doi.org/10.1038/ncomms7260. 167. Enattah, N.S., Sahi, T., Savilahti, E., Terwilliger, J.D., Peltonen, L., and 179. Dray, S., and Dufour, A.B. (2007). The ade4 package: Implementing the €rvela Ja €, I. (2002). Identification of a variant associated with adult-type hy- duality diagram for ecologists. J. Stat. Softw. 22, 1–20. https://doi.org/ polactasia. Nat. Genet. 30, 233–237. https://doi.org/10.1038/ng826. 10.18637/jss.v022.i04. 14 Current Biology 31, 1–14, June 7, 2021 Please cite this article in press as: Yaka et al., Variable kinship patterns in Neolithic Anatolia revealed by ancient genomes, Current Biology (2021), https://doi.org/10.1016/j.cub.2021.03.050 ll Report STAR+METHODS KEY RESOURCES TABLE REAGENT or RESOURCE SOURCE IDENTIFIER Biological Samples Ash002 This study 2 Ash033 This study 33 Ash040 This study 40 Ash128 This study 128 Ash129 This study 129 Ash131 This study 131 Ash133 This study 133 Ash136 This study 136 cth006 This study 30006 cth728 This study 2728 cth842 This study 2842 cth747 This study 5747 pch034 This study 21981 CCH144 This study 5357 CCH285 This study 21855 CCH163 This study 2017 CCH289 This study 1885 CCH290 This study 2033 CCH294 This study 2779 CCH311 This study 8587 cth739 This study 11739 cth217 This study 20217 Chemicals, Peptides, and Recombinant Proteins RNase Away N/A Sodium Hypochloride Sigma Aldrich Cat#S7653 HPLC water Sigma Aldrich Cat#270733 Ispropanol Merck Cat#1009952500 Proteinase K Thermo Fisher Scientific Cat#E00491 Guanidine Hydrochloride Sigma Aldrich Cat#50950 Tween-20 BioShop Cat#TWN508 Ethanol Isolab Cat#920.026.2500 EDTA disodium salt dihydrate Sigma Aldrich Cat#E5134 Critical Commercial Assays High Sensitivity DNA Kit (Bioanalyser 2100) Agilent Technologies Cat#5067-4626 MYbaits Human Whole Genome Capture Arbor Biosciences (Ann Arbor, MI) Cat# 302508.v5 Kit (African baits) High Sensitivity D1000 Screen Tape Agilent Technologies Cat# 5067-5584 (Tapestation 2200) MinElute PCR Purification Kit QIAGEN Cat#28004 Deposited Data Ash002 BAM file European Nucleotide Archive (ENA) ENA: ERS4811035 Ash033 BAM file European Nucleotide Archive (ENA) ENA: ERS4811084 Ash040 BAM file European Nucleotide Archive (ENA) ENA: ERS4811085 (Continued on next page) Current Biology 31, 1–14.e1–e18, June 7, 2021 e1 Please cite this article in press as: Yaka et al., Variable kinship patterns in Neolithic Anatolia revealed by ancient genomes, Current Biology (2021), https://doi.org/10.1016/j.cub.2021.03.050 ll Report Continued REAGENT or RESOURCE SOURCE IDENTIFIER Ash128 BAM file European Nucleotide Archive (ENA) ENA: ERS4811086 Ash129 BAM file European Nucleotide Archive (ENA) ENA: ERS4811087 Ash131 BAM file European Nucleotide Archive (ENA) ENA: ERS4811088 Ash133 BAM file European Nucleotide Archive (ENA) ENA: ERS4811089 Ash136 BAM file European Nucleotide Archive (ENA) ENA: ERS4811090 cth006 BAM file European Nucleotide Archive (ENA) ENA: ERS4811091 cth728 BAM file European Nucleotide Archive (ENA) ENA: ERS4811092 cth842 BAM file European Nucleotide Archive (ENA) ENA: ERS4811093 cth747 BAM file European Nucleotide Archive (ENA) ENA: ERS4811094 pch034 BAM file European Nucleotide Archive (ENA) ENA: ERS4811095 CCH144 BAM file European Nucleotide Archive (ENA) ENA: ERS4811096 CCH285 BAM file European Nucleotide Archive (ENA) ENA: ERS4811098 CCH163 BAM file European Nucleotide Archive (ENA) ENA: ERS4811097 CCH289 BAM file European Nucleotide Archive (ENA) ENA: ERS4811099 CCH290 BAM file European Nucleotide Archive (ENA) ENA: ERS4811100 CCH294 BAM file European Nucleotide Archive (ENA) ENA: ERS4811101 CCH311 BAM file European Nucleotide Archive (ENA) ENA: ERS4811102 cth739 BAM file European Nucleotide Archive (ENA) ENA: ERS4811103 cth217 BAM file European Nucleotide Archive (ENA) ENA: ERS4811104 Oligonucleotides 49 IS1_adapter.P5: 50-A*C*A*C*TCTTTCC Biomers CTACACGACGCTCTTCCG*A*T*C*T-30 (* indicates a PTO bond) 49 IS2_adapter.P7: 50-G*T*G*A*CTGGAG Biomers TTCAGACGTGTGCTCTTCCG*A*T*C*T-30 (* indicates a PTO bond) 49 IS3_adapter.P5+P7: 50-A*G*A*T*CGGAA* Biomers G*A*G*C-30 (* indicates a PTO bond) 49 IS4: (5¢-AATGATACGGCGACCACCGAG Biomers ATCTACACTCTTTCCCTACACGACGCT CTT 3¢) 49 IS5: (5¢AATGATACGGCGACCACCGA) Biomers 49 IS6: (5¢ AAGCAGAAGACGGCATACGA) Biomers 49 P5 indexing: (5¢-AATGATACGGCGACC Biomers ACCGAGATCTACACxxxxxxxACACTCT TTCCCTACACGACGCTCTT 3¢) where x is one of 7 different 7 bp indexes 49 P7 indexing: (5’-CAAGCAGAAGACGGC Biomers ATACGAGATxxxxxxxGTGACTGGAGT TCAGACGTGT 3’) where x is one of 22 different 7 bp indexes Software and Algorithms 50 MergeReadsFastQ_cc.py https://bioinf.eva.mpg.de/fastqProcessing/ 51 AdapterRemoval https://github.com/MikkelSchubert/adapterremoval 52–54 Burrows-Wheeler Aligner BWA aln 0.7.15 http://bio-bwa.sourceforge.net/ 50 FilterUniqueSAMCons.py https://bioinf.eva.mpg.de/fastqProcessing/ 55 PMDtools https://github.com/pontussk/PMDtools 56 Samtools-0.1.19 https://github.com/samtools/samtools 57 ANGSD http://popgen.dk/angsd/index.php/ANGSD 58 HaploGrep2v2.1.1 https://haplogrep.i-med.ac.at/ 59 EIGENSOFT https://github.com/DReichLab/EIG (Continued on next page) e2 Current Biology 31, 1–14.e1–e18, June 7, 2021 Please cite this article in press as: Yaka et al., Variable kinship patterns in Neolithic Anatolia revealed by ancient genomes, Current Biology (2021), https://doi.org/10.1016/j.cub.2021.03.050 ll Report Continued REAGENT or RESOURCE SOURCE IDENTIFIER 20 ADMIXTOOLS https://github.com/DReichLab/AdmixTools 19 ADMIXTURE https://dalexander.github.io/admixture/download.html 60 PLINK https://www.cog-genomics.org/plink2 61 PONG https://github.com/ramachandran-lab/pong 34 NgsRelate https://github.com/ANGSD/NgsRelate 35 lcMLkin https://github.com/COMBINE-lab/maximum- likelihood-relatedness-estimation 36 READ https://bitbucket.org/tguenther/read/src/master/ 62–64 HIrisPlex http://hirisplex.erasmusmc.nl/ Other Agencourt AMPure XP beads (60 mL) Beckman Coulter Cat#A63881 T4 Polynucleotide Kinase (T4 PNK) Thermo Fisher Scientific Cat#EK0032 T4 DNA Ligase Thermo Fisher Scientific Cat#EL0011, EL0014 Adenine Triphosphate (ATP) Thermo Fisher Scientific Cat#R0441 T4 DNA Polymerase Thermo Fisher Scientific Cat#EP0062 dNTP Set Thermo Fisher Scientific Cat#R0182, R0181 dNTP Mix Thermo Fisher Scientific Cat#R1121, R1122 Bst polymerase, large fragment New England Biolabs Cat#M0275S 10X ThermoPol reaction buffer New England Biolabs Cat#B9004S Amplitaq Gold 360 DNA Polymerase Thermo Fisher Scientific Cat#4398833 (with AmpliTaq Gold Buffer) KAPA HiFi HotStart Uracil+ Kit Kapa Biosystems Cat#KK2801 Herculase II Fusion DNA Polymerase Agilent Technologies Cat#600675 10X Tango Buffer Thermo Fisher Scientific Cat#BY5 RESOURCE AVAILABILITY Lead Contact Further information and requests for resources and reagents should be directed to and will be fulfilled by the Lead Contacts, Mehmet Somel (

[email protected]

) and Reyhan Yaka (

[email protected]

). Materials Availability This study did not generate new unique reagents. Data and Code Availability Ancient genome data produced for this study is deposited at the European Nucleotide Archive (ENA) under the accession number PRJEB39316 as BAM files. The computer simulation code used in the study is available at github.com/CompEvoMetu/kinshipsim. Bash scripts and R code used in regular population genetic and statistical analyses are available upon request. The supplemental data tables (identified throughout the text by the prefix Z) are available at Zenodo Data: https://doi.org/10.5281/zenodo.4587657. EXPERIMENTAL MODEL AND SUBJECT DETAILS Archaeological background Neolithic buildings and households The concept of ‘‘house’’ refers to a social institution through which societies define a particular type of membership group, i.e., the ‘‘household.’’ What defines a household is based upon the cooperating individuals’ criteria for relatedness, task-orientation, and co- residence.50 These criteria are socio-culturally constructed and therefore highly variable across societies. For example, household members can be genetically related, as in genetic kin-based family organizations, but a household can also be composed of individuals who co-reside and share tasks with reference to relatedness criteria other than genetic ties. Nevertheless, these criteria of relatedness, genetic or otherwise, are considered legitimate only if they express continuity through successful invention and manipulation of con- cepts such as descent, belonging and other social differences based on age, sex and skill, all of which are also actively employed in terminologies of kinship or affinity.51 Within this context, long-lasting architecture has been the most potent embodiment of inclusion and relatedness, through which a household membership and its history can be represented via a variety of symbolic activities.52–55 Current Biology 31, 1–14.e1–e18, June 7, 2021 e3 Please cite this article in press as: Yaka et al., Variable kinship patterns in Neolithic Anatolia revealed by ancient genomes, Current Biology (2021), https://doi.org/10.1016/j.cub.2021.03.050 ll Report Some of the earliest long-lasting residential architecture, considered to be the primary context for the socialization of household members, is found in early Neolithic SW Asia, c. 10th-7th millennia cal BCE. The criteria that define relatedness among the household members of these societies, however, have long been debated: were the co-residents genetic kin, or did other factors determine household membership? Based on the size and form of the buildings, it has been suggested that the earlier curvilinear structures of the c.10th-9th millennium cal BCE were used by extended families, perhaps related to polygamous social structures, whereas the adoption of larger rectilinear and compartmentalized buildings of 8th-7th millennium cal BCE reflects a shift to close genetic kin-based organization.56,57 Alternatively, given the relatively small size of most Neolithic residential structures, regardless of shape, it has been postulated that these buildings were mostly used by nuclear families.38 Other researchers hold that the transition from some form of nuclear family household to increasingly autonomous family households occurred during the Pre-Pottery Neolithic B (PPNB).38,58–62 Yet others argue that the increasingly autonomous households only occurred in the Late Neolithic as an element of multiscalar transformations of Neolithic communities in this period.63–65 Research on mortuary practices also underlines the broad regional changes through time, including suggested shifts from com- munity membership to increasingly separate and autonomous household organizations in the PPNB.1,66 Meanwhile, the repeated construction of mudbrick buildings at the same location over multiple generations, sometimes even maintaining the position of in- ternal structures such as hearths, implies the presence of distinct household identities in these societies.10,62,67 Do co-burials represent households? One potential source of information that could help resolve the nature of Neolithic household composition and social organization comes from burials within buildings during their occupancy. Neolithic SW Asian societies frequently practiced the burial of individuals beneath the floors of domestic buildings, usually during the time these structures were inhabited.28,29 A common assumption has been that these burials were of household members and were related in some way, possibly genetically or through kinship based on other factors.27,30,31 This could include households composed of families of closely genetically related individuals, extended fam- ilies, multi-family households, or social units where genetic relatedness had little role. In reality, however, it remains unclear whether individuals buried under house floors lived in the same building as part of a co-resident group, i.e., whether they represented households.32,68 If co-burials were indeed household members, we may expect them to share specific attributes more with each other than with other co-burial groups; most notably, elements of their diet. Evidence on dietary similarity among Neolithic Anatolian households is currently equivocal. A 2015 study reported no dietary differentiation among Çatalhöyük co-burials in different buildings.33 A 2020 study using a wider dataset again from Çatalhöyük reported statistically significant differentiation in carbon and nitrogen isotope values among buildings.34 This same work further reported significant dietary differences among neonates buried in different buildings. Still, possible confounding factors that could influence stable isotope profiles (age and sex for adults, pathological condi- tions for neonates) were not explicitly controlled for in these analyses and we therefore consider these results as preliminary. There exist additional arguments against the hypothesis that co-burials represent households. It appears that the average number of burials per residential structure is generally too small to represent full households.69 For instance, in As xıklı Höyük, only 90 burials have been discovered from more than 400 rooms excavated.70 This suggests additional factors influenced the choice of burial loca- tions and type of funerary treatments of individuals. Furthermore, an apparent excess of burials in some residential buildings, in sites such as Çatalhöyük,62 and occasionally at other sites such as Abu Hureyra and Bestansur (although the relevant buildings here may not be ordinary residential structures),71 implies a special role of some residential buildings for burial of individuals who probably had originally lived in other residences. Düring and Marciniak’s (2005) analysis32 of Çatalhöyük houses also indicates that human burials in buildings may have served to advertise the temporal continuity (history) of the buildings, which thus ensured the continuity and suc- cess of the household, regardless of their genetic ties. If co-burials do not represent household members, their interment in the same buildings could be driven by at least two distinct traditions. First, individuals may be buried together because they died at the same time (e.g.,72). This could also include mass burials following disease outbreaks.73 However, in the case of co-burials in Neolithic Anatolian settlements, the mortuary context and mor- tality profiles do not indicate mass burials. The evidence overall suggests these were collective burials, where individuals were buried sequentially, as is prevalent at Neolithic Çatalhöyük as well as other sites.74 Second, co-burial patterns may reflect local traditions stipulating specific burial arrangements of individuals who do not belong to the same household. Such traditions could involve burying individuals of specific status or social backgrounds together. The moti- vation behind these traditions may be to maintain social and economic ties among groups and to ‘‘consolidate community member- ship’’75. For instance, it has been suggested that the emergence of cemeteries during the Natufian period could have represented ‘‘the establishment or strengthening of special interest groups, inheritance of corporate property, and territorial ownerships’’76. Another example could be traditions such as described for Aboriginal Australian groups where the corpses of deceased young chil- dren were retained by the mothers to be interred with an adult male who dies next (Musgrave 1930, cited in77). If such arrangements were in place also in Neolithic Anatolian settlements, we might expect no direct social or genetic connection among co-burials. Relatedness among co-burials Studies on genetic relatedness among co-burials in Neolithic SW Asia have yet been limited. Most work to date relies on dental metric and non-metric traits as proxies for genetics,3,78–80 and one recent study used mitochondrial DNA.5 These studies have reported patterns consistent with endogamy34,78 or with matrilocality in Neolithic Levantine sites,79 and with patrilocality at Çatalhöyük.3,80 Meanwhile, the Çatalhöyük studies, based either on dental analysis or mitochondrial DNA, found no evidence for individuals buried in the same building being more closely related to each other than to individuals buried in other buildings.3,5,80 Still, owing to the e4 Current Biology 31, 1–14.e1–e18, June 7, 2021 Please cite this article in press as: Yaka et al., Variable kinship patterns in Neolithic Anatolia revealed by ancient genomes, Current Biology (2021), https://doi.org/10.1016/j.cub.2021.03.050 ll Report inability to estimate the degree of kinship using dental traits and mitochondrial data, the question of kinship among co-burials in Neolithic SW Asia has remained largely unresolved. Ancient genomics, in turn, can be used as a powerful tool to determine genetic relatedness and kinship among households of the dead, allowing further consideration of how burial locations might have structured relationships between households of the living and the construction of kinship, as well as social memory and social traditions in gen- eral. With some temporal depth to our study we are also able to consider if there might be temporal trends in these social practices over the long term. Description of archaeological sites Description of Asxıklı Höyük Asxıklı Höyük, located in the Volcanic Cappadocia Region in eastern Central Anatolia is one of the earliest sedentary communities of the region, radiocarbon dated to the mid-9th and 8th millennium BCE (8350-7300 cal BCE). Excavations at the site started in 1989 as salvage excavations under the direction of Prof. Ufuk Esin (_Istanbul University). Since 2010, the research and excavation project has been led by Prof. Mihriban Özbasxaran (_Istanbul University) and Günes x Duru (Mimar Sinan Fine Arts University) in collaboration with an international team from various universities and institutions. The first inhabitants of Asxıklı settled near the western bank of the Melendiz River. The river, flowing from the Ihlara Valley, and the volcanic landscape provided a rich habitat for various animal and plant species. A warm climate and park-woodland vegetation was dominant in the region during the beginning of the Holocene.6,67 The mid-9th millennium BCE inhabitants of the site lived in semi- subterranean, oval mudbrick buildings that were reconstructed and renewed periodically at the same location. Characteristics of these buildings include hearths, a small platform, grinding stones and burial pits. Daily life was organized outside the buildings, in open activity areas, where many of the daily tasks were conducted.81 Archaeozoological data attest to broad spectrum hunting during the 9th millennium BCE, including a variety of small prey animals, birds and fish, although the main focus was always on sheep/goat.7,82 Analyses of micromorphology and soil chemistry, and the pres- ence of primary dung layers attest to the fact that animals were kept on-site, inside wattle and daub enclosures. Archaeozoological data, as well as isotope analysis show that caprines, specifically sheep, were kept in the settlement from the earliest levels; management and the domestication process continued all through the sequence.7,82–84 The community had the knowledge and the experience of growing plants and cultivating wild and domestic cereals. Wild plants, legumes and fruits were among the gathered plants. With the start of the 8th millennium BCE, changes took place in architecture and settlement patterns. Rectangular structures re- placed the oval and semi-subterranean buildings. These rectangular buildings were mostly single-roomed. Although few in number, buildings with two or three-room buildings are also present. Toward the end of the settlement occupation, buildings started to cluster. Building clusters, generating neighborhoods, were separated by narrow spaces or passages with access to communal middens.70 Separated by a ‘‘gravel street’’ from the residential area, to the southwest of the present mound, lies a building complex distinguished from domestic buildings in terms of its plan, size, construction material, internal architectural features and floor and wall treatment. The architectural features and the characteristics of the archaeological material (i.e., the dominance of wild cattle) permit interpre- tation of this area as a ‘‘public area’’ where communal consumption and certain ceremonies took place. Evidence of communal ac- tivities in this area indicates the continuity of the collective way of living,70 while the daily activities in the residential area most prob- ably took place on the flat roofs and inside the dwellings. During this period, hunting and gathering continued, though with less importance, and subsistence was based mainly on sheep and goat, but these animals were no longer kept within the settlement.6 Two concepts, a communal way of life and continuity, characterized the social organization of the Asxıklı community. Interaction with other regions and communities had a certain tempo during the mid-9th millennium BC, as evidenced by the material culture. However, simultaneous with the increasing focus on the full establishment of sedentism and caprine management, the pace of inter- action decreased, only to increase again during the last 200-300 years of site occupation, corresponding roughly to the second half of the 8th millennium BC. This is well illustrated by the sudden appearance of non-local materials and technologies during this period. In contrast with this pattern of temporal change, continuity of certain elements, such as the location of the buildings and interior archi- tectural features, constant renewal and maintenance of the floors and walls of buildings, and the transferring of objects and know- how was another factor that characterized the social fabric of the community. The inhabitants managed to live in cohesion throughout the occupation sequence and the communal way of life was maintained with new solutions, but also continuity through temporal changes and transformations was the main characteristic of the newly established Neolithic way of life at As xıklı Höyük. The burial customs consist of intramural, single sub-floor inhumations. The deceased were buried in pits under the floors of the buildings in a flexed position. To date, 90 burials have been found in 400 rooms. Although this tradition was not subject to change for hundreds of years, new practices arose during the latest levels of the occupation at the site. The dead were not buried with any items of personal adornment during the mid-9th millennium BCE. However, changes can be observed toward the mid-8th millennium when some individuals are found buried with ornaments. Of the 82 individuals subjected to bioarchaeological analysis, adults consti- tute 60% while children make up 40%. Of the 46 adults for whom sex can be determined, females constitute 65% while males consti- tute 35%, a marginally significant difference (binomial test p = 0.054). In terms of the daily activities conducted by the As xıklı Höyük individuals, task-related pathologies of adults show that the shoulders, hips, ankles, elbows and knees were affected by osteoar- thritis, possibly stemming from habitual stress. Males exhibit significant degrees of shoulder osteoarthritis, followed by their elbows and hips; for females the ankles were most affected by this disease, followed by the shoulders and hips. This may suggest that males were routinely engaged in activities such as carrying heavy loads, throwing, walking and kneeling, and females were probably engaged in activities that involved walking and squatting.85 Current Biology 31, 1–14.e1–e18, June 7, 2021 e5 Please cite this article in press as: Yaka et al., Variable kinship patterns in Neolithic Anatolia revealed by ancient genomes, Current Biology (2021), https://doi.org/10.1016/j.cub.2021.03.050 ll Report Five of these burials genetically studied here were interred in Building 1 and Building 3 of Asxıklı Höyük Layer 4 (Figure 3A). These are buildings in direct proximity with less than 1 m between them, which showed temporal overlap in their periods of use, and which shared a common open workspace between them.6 We therefore treated the individuals from both buildings as a cluster of co- burials, who might represent members of the same household. Description of Boncuklu Höyük Boncuklu is situated in the middle of the SW Konya basin (37 45’N 32 52’E) and lies 33.4 km northwest of the site of Pınarbasxı and 9.5 km northeast from Çatalhöyük. The site was discovered during the archaeological survey under the direction of Prof. Douglas Baird from the University of Liverpool, UK. Excavations directed by Baird began in 2006 and continue at the present time.9 Baird was joined by co-directors, Prof. Andrew Fairbairn of University of Queensland, Australia and Dr. Gökhan Mustafaog lu of Ankara Haci Bayram Veli University, Turkey, since 2011. Occupation of the site is documented from 8300-7600 cal BCE directly through radiocarbon dating. However, stratigraphic and material evidence suggest a slightly longer span of occupation.9,86,87 The exploitation of wild resources seems to have predominated, especially wild cattle and boar, fish and wetland birds, along with nuts and fruits from surrounding hill areas.9,87 Small-scale cultivation of wheat, lentils and peas was an additional modest component of subsistence activities.9 The chipped stone industry was microlithic, in significant contrast to broadly contemporary Levantine PPNB and northern Fertile Crescent assemblages and thus shows significant continuities with the earlier, local Epipalaeolithic and the earlier 10th/early 9th millennium BC community at Pınarbasxı in technology and raw material.9,86 Continuities between Epi- palaeolithic and early Holocene forager communities and the community at Boncuklu are clear. This evidence is supported by sig- nificant genetic continuity.21 By 8300 cal BCE it appears local foragers adopted domestic plants from areas to the south and east, incorporating them into their traditional wetland exploitation practices.9 They were probably introduced to the region as a conse- quence of the far-reaching and continuous interactions with neighboring regions from the Epipalaeolithic through the 10th-early 9th millennia cal BCE, as also documented at earlier and contemporary Pınarbasxı.9 The site possessed a number of sunken-floored sub-oval domestic buildings with mudbrick walls. The households display highly structured use of internal house space, divided into a ‘clean’ area presumably for sleeping, socializing and food consumption and a ‘dirty’ kitchen area.10,87 The houses were very regularly refurbished, plastered and modified, especially the hearth areas, showing the intensity of domestic use. The floor area of these houses is small and modeling shows small intimate household units with intensive and repetitive domestic practices.10 Evidence of ritual and symbolism in the ‘clean’ areas, including burials, is regular10 and differ- entiated from house to house suggesting creation and maintenance of distinctive household identities.10 The Boncuklu houses were also repeatedly and continuously reconstructed over multiple generations in the same location, a practice at some other 10th-7th millennia cal BCE sites in the surrounding regions, for example to the northeast at As xıklı from 8300 cal BCE,67 just to the south at Çatalhöyük from 7100 cal BCE, in the Levant at PPNA Jericho and in PPNB Tell Halula.66 This seems to be a symbolic statement 62 88 of household continuity. This expression of continuity and identity suggests small tight-knit households in continuous occupation of these domestic structures, whatever the nature and dynamism of their composition, which we can start to grasp through aDNA ev- idence. Nevertheless, there seems evidence that some broader corporate social practices cross-cut households, including some practices involved in food and resource exploitation in the wider landscape.10 Primary inhumations were placed under the ‘clean’ area of the houses during their occupation. It seems the dead ‘ancestors’, whether biologically related or not, were kept close to the living. In the case of Boncuklu the modest numbers of burials under house floors, maximum 5 and more usually 1-3, per house, suggest many of these could easily be members of the household that lived in these buildings, although we certainly cannot assume that to be so. Nevertheless, reflecting the fact they occurred within the houses while still in use and that these were small-sized buildings with very intimate spaces, presumably means the co-burial of the dead expressed some type of relationship to the households of the living, and thus represented a symbolic statement of connection be- tween the dead and the living. Indeed, evidence attests to ongoing attention to burials and knowledge of their location.10 There were also primary burials and burials of deliberately disarticulated human remains, including human crania, in open areas between buildings in areas of midden accumulation.10 More than 37 Neolithic burials, plus a minimum of 274 individual bones and 129 isolated finds of human remains have been studied, although more have been excavated. Nine skeletal samples from securely stratified 9th-8th millennia cal BCE burials in Areas H, K, and M provided sufficient aDNA preservation for genetic analysis (Table Z2), and thus genomic data.20,21 Boncuklu human remains do not reflect significant disproportionate representation of males or females and there is an even spread across most age categories, including children and young, middle and old adults, with a slight, but not unusual, lesser presence of older children/adolescents. Five of these burials (ZHF – Grave 14, ZHJ – Grave 15, ZHAF – Grave 18, ZHAG – Grave 18 and ZHBJ – Grave 30), including 2 pairs of individuals with first-degree genetic relationships were all articulated primary inhumations stratified within a sequence of 2 build- ings in Area H, Building 12 and Building 14. Building 12 predates Building 14 and, indeed, the foundation cut for Building 14 removed the northern edge of Building 12 (Figure 3B). Building 14 seemed a direct replacement for Building 12, an example of the continuous reconstruction of the buildings in the same locations, although in this case with some shift of the house to the north. ZHBJ, the likely brother of ZHAF (Table S3), was buried in the northern part of Building 12 (Figure 3B). ZHAF, his likely sister, was buried in the south- ern part of Building 14 (Figure 3B). This seems a deliberate attempt to keep these individuals close at death and points to the close connections between the living and dead in these households. Both these burials had similar orientations, approximately west-east/ northwest-southeast with heads at the West. It is thus tempting to think this might also reflect their close relationship. It may well have done, but these are the most common burial orientations at Boncuklu, among c. 70% of the analyzed burials and so might simply reflect these broader patterns. ZHAG, a female perinatal child that likely died at birth, was placed directly against the pelvis of e6 Current Biology 31, 1–14.e1–e18, June 7, 2021 Please cite this article in press as: Yaka et al., Variable kinship patterns in Neolithic Anatolia revealed by ancient genomes, Current Biology (2021), https://doi.org/10.1016/j.cub.2021.03.050 ll Report ZHAF, but was genetically unrelated to that adult female ZHAF and also unrelated to ZHF and ZHJ in the same building. It is, of course, possible her mother lived in Building 14 but was genetically unrelated to the other adults buried there, or that as a result of some form of connection to the child and/or her mother she was buried with ZHAF, albeit from a household who lived elsewhere. ZHF and ZHJ, most likely adult son and mother respectively (Table S3), were located in the more eastern parts of Building 14 (Fig- ure 3B). The orientation of their bodies was not dissimilar, ZHF had the common northwest-southeast and ZHJ a north-south orien- tation. However, their heads were at opposite ends of the grave-cut, ZHF to the northwest and ZHJ to the south. It is, therefore, diffi- cult to suggest that orientation at Boncuklu was a direct expression of close family relationships. ZHAJ was a primary inhumation burial of an adult male that predated Building 14 and seems to have been located in an open area. ZHB was the burial of an adult female burial post-dating Building 14. Overlying stratigraphy was eroded so it was unclear whether the grave for ZHB was cut through the floor of a building or was placed in an external area. These two burials do not show any close genetic relationships to the other sampled individuals. The other burials analyzed, genetically unrelated to any of these burials in Area H, was one adult male primary inhumation, ZKO, buried in Building 9 in Area K, broadly contemporary but c. 15 m from the cluster in Area H. ZMOJ was a primary inhumation in an external area in the middens of Area M, located c. 25 m from the cluster in Area H. Although well stratified in Neolithic deposits the chronological relationship with the Area H cluster and ZMOJ is not clear. Description of Çatalhöyük Located 9 km to the south of Boncuklu Höyük on the Konya Plain in Central Anatolia, the site of Çatalhöyük was discovered and first excavated between 1961-1965 by James Mellaart (British Institute of Archaeology at Ankara), and later between 1995-2015 by Ian Hodder (Stanford University). Çatalhöyük was designated a UNESCO World Heritage Site in 2012. The site consists of two separate mounds or ‘‘tells.’’ The larger East Mound covers an area of 13 ha and has been dated to c. 7100- 5950 cal BCE,11 corresponding roughly to the Ceramic Neolithic period. The smaller West Mound dates to the Early Chalcolithic and was occupied until the middle of the 6th millennium BCE.89 The Neolithic East Mound, until c. 6300 cal BCE, is characterized by dense clusters of mudbrick domestic structures interspersed with external spaces used for refuse disposal, animal penning and other daily activities. To date, large-scale, clearly identifiable public structures have not been documented at the site. Instead, individual houses at Çatalhöyük appear to have served as the focal point not only for domestic activities such as craft production, food storage and processing, but also ritual behaviors such as burials, wall paintings and other architectural embellishments associated with an elab- orate symbolic repertoire and reflecting a complex socio-cultural environment.90 There is ample evidence for the cultivation of domesticated cereal crops and the keeping of domesticated sheep and goats at the site.91,92 Wild animal species, including aurochs, also formed part of the diet, and in the later occupation phases (6500-5950 cal BC) there is evidence for the herding of domesticated cattle.92,93 Between 1993 and 2017 the skeletal remains of over 700 individuals had been recovered from stratified Neolithic contexts at Çat- alhöyük.4 Primary inhumations (n = 471 individuals) placed beneath the floors of houses are the dominant burial type at the site.2,40 Individuals were typically buried in narrow oval pits under the eastern and northern platforms of the central room, although prenates, neonates and infants were also recovered from within side rooms and near ovens and hearths.2,40,94 Secondary burials of loose or partially articulated skeletal remains, often in association with primary burials, are also observed, although less frequently.39,40 Intra- mural burials became increasingly rare toward the end of the occupation of Çatalhöyük East,12,40 while burials are almost completely absent within the settlement on the Chalcolithic West Mound.95,96 Of the 471 individuals from primary burial contexts,97 there are 178 adults (20+ years), 29 adolescents (12-20 years), 90 children (3-12 years), 67 infants (2 months-3 years), 85 neonates (0-2 months), and 22 prenates (> 38 weeks in utero). Among the adults and adolescents whose sex could be determined (n = 155), 89 individuals (57%) were assessed as females or possible fe- males, while 66 individuals (43%) were assessed as males or possible males, a marginally significant difference (binomial test p = 0.077). Description of Barcın Höyük Located in the Yenisxehir Valley in the province of Bursa in northwestern Turkey, the site of Barcın Höyük yielded an uninterrupted stratigraphic sequence from 6600 to 6000 cal BCE.18 The settlement was built on a low natural elevation in what would have been a marshland valley.98 The Neolithic levels at Barcın Höyük, which lie beneath a relatively thin deposit of later levels dating to the Chalcolithic, Bronze Ages and the Byzantine period, are thick and exceed 4.5 m in most places at the site. Called level VI, the Neolithic phase is divided into seven subphases: VIe (earliest level) through VIa. The VIe levels of the site represent the earliest farming community known to date in the Marmara Region.18,19 The initial pioneer communities who arrived here around 6600 cal BCE brought with them crops to cultivate and animals to herd.99,100 With regards to plants, domesticated varieties of cereals and pulses were plentiful.101 Sheep and cattle were the preferred herd animals although goats were also present while hunting only contributed a minor part of the diet.102,103 Extensive organic residue analyses on pottery demonstrate that the inhabitants of Barcın Höyük relied heavily on dairy products.104 This observation confirms those made by Evershed and colleagues for later sites in the Marmara Region.105 The initial settlers in the region were accomplished potters even though pottery use was initially limited and indirect methods of heating foods were preferred.106 Within a century however, thin-walled finely made burnished pots become plentiful. Building on a consistent tradition, recipes of manufacture and temper changed over the ensuing centuries.106,107 The residents of Barcın Höyük lived in rectilinear timber frame houses with wood and mud walls.18 Houses tended to be in rows, surrounded by courtyard areas where a variety of activities were carried out. Current Biology 31, 1–14.e1–e18, June 7, 2021 e7 Please cite this article in press as: Yaka et al., Variable kinship patterns in Neolithic Anatolia revealed by ancient genomes, Current Biology (2021), https://doi.org/10.1016/j.cub.2021.03.050 ll Report Burials associated with the settlement were placed within and near structures. Interestingly, many infants were buried within the house proper beneath floors while adults were typically placed in the courtyard areas. Children often tended to be buried outside but closer to the structures, sometimes beneath the floors of the verandas in front of the houses. Although intensively analyzed for DNA,22,23,108 the Barcın Höyük skeletons await final anthropological analyses. Based on prelim- inary data, adults appear to comprise 38% (46 burials) of the 121 burials that come from primary burial contexts.109 Of the skeletons that can be identified based on sexual characteristics, nearly two thirds of these appear to be females or possibly females. Subadults including adolescents, children, infants and neonates comprise the remaining 62% of the assemblage. Description of Tepecik-Çiftlik Tepecik-Ciftlik is located in the Volcanic Cappadocia region of Central Anatolia in the Melendiz/Ciftlik Plain. The excavators suggest it was occupied from the end of the Aceramic Neolithic Period until the early Chalcolithic Period, between c.7500-5800 cal BCE.17 The Pottery Neolithic levels show evidence of agriculture and animal breeding, as well as continued hunting and gathering. The site is in close proximity to major obsidian ore beds in the region and is notable for its large amount of obsidian tool remains. Further infor- mation about the site may be found at.17 A 2016 report on Tepecik-Ciftlik indicated that over 170 individuals’ remains dating to the Neolithic levels, buried inside buildings and in open areas20 had been excavated. A collective burial was also found, and is thought to have been used for successive burials, both primary and secondary.110 It includes at least 42 individuals of both sexes and various ages. Description of archaeological material This section describes bioarchaeological characteristics of the individuals from As xıklı Höyük, Çatalhöyük and Boncuklu Höyük. Some of this data are unpublished. Barcın Höyük and Tepecik-Çiftlik individuals included in this study have been described in the supple- mentary material of Mathieson et al.23 and Kılınç et al.,20 respectively. Sex was estimated using dimorphic markers, and individual ages-at-death were estimated using standard methods such as hu- man growth and epiphyseal fusion, dental calcification and bone maturity/size.111 The sex of subadult individuals listed below have been determined based on genetic data produced in this study (Table Z2). Description of Asxıklı Höyük individuals SK2 (Level 1/2A; Building AB): the burial of a young adult female. Double burial. SK2 was buried in the same burial pit of a male, slightly later. The pit is located in a one-room rectangular building of the mid-8th millennium BCE settlement. Radiocarbon dating places the individual to 7585-7475 cal BCE (Table Z2). SK33 (Level 2C, Building C): the burial of a child, buried under the floor of a rectangular planned kerpiç (mudbrick) building. Radio- carbon dating places the individual to 7945–7890 cal BCE (9%) or 7870–7595 cal BCE (86%) (Table Z2). Building C was renewed 10 times at the same location (Figure 3A),112 where this child’s burial was contemporary with its eighth renewal phase. Excavated in 1991. SK40 (Level 2B, Building BH): the burial of an old adult female. Sub-floor inhumation in a rectangular kerpiç building of the 8th mil- lennium BCE settlement. One of the three individuals buried in the same building: a one-month old infant and a middle adult female. Radiocarbon dating places the individual at 7935–7915 cal BCE (1%) or 7825–7590 cal BCE (94%) (Table Z2). SK128 (Level 4, Building 3): the burial of a female child. She is one of the two individuals buried in the same building. Radiocarbon dated to 8225–7955 cal BCE (95%) (Table Z2). SK129 (Level 4, Building 3): the burial of a young adult female, buried in a semi-subterranean oval building. She is one of the two individuals buried in the same building. Excavated in 2011; primary burial; radiocarbon dated to 8170–8115 cal BCE (6%), 8060–8045 cal BCE (1%), 8010–7985 cal BCE (1%), 7970–7735 cal BCE (86%) (Table Z2). SK131 (Level 3E/4, Building 1): the burial of a female child, exposed lying on the pavement of a hearth in a semi-subterranean oval building. This is an exceptional burial, in position and in location. Four more individuals were buried in the same building. The burial was exposed in 2012. She was radiocarbon dated to 8200–8110 cal BCE (16%) or 8095–8035 cal BCE (7%) or 8015–7740 cal BCE (72%) (Table Z2). SK133 (Level 3E/4, Building 1): the burial of an old adult female, the oldest member of the community thus far excavated. She was one of the five individuals buried in the same oval, semi-subterranean building, B.1. She was a primary burial and was radiocarbon dated to 8170–8115 cal BCE (8%), 8060–8040 cal BCE (1%), 8010–7980 cal BCE (2%), 7975–7735 cal BCE (84%) (Table Z2). Exca- vated in 2012. SK136 (Level 3E/4, Building 1): the burial of a young adult female, one of the five individuals from Building 1. She was a primary burial, and was radiocarbon dated to 8175–8110 cal BCE (7%) or 8090–8075 cal BCE (1%) or 8065–8040 cal BCE (1%) or 8015– 7705 cal BCE (84%) or 7695–7655 cal BCE (2%) (Table Z2). Excavated in 2015. Description of Çatalhöyük individuals Sk.5357 (burial feature 576, Level South K, Early period, Building 17): primary burial of a male infant. He was 9 months ± 3 months at death based on dental development. It was buried in a flexed position along the east wall of B.17 in association with red pigment and traces of reed basketry. The burial was excavated in 1999. Radiocarbon dating places this individual between 7035–6680 cal BCE (93%) or 6670–6650 cal BCE (2%) (Table Z2). Sk.21855 (burial feature 8214, Level South K, Early period, Building 17): the primary burial of a female child. She was 4 years ± 1yr at death based on dental development. It was placed in a flexed position in a burial cut along the west wall of B.17. The burial was exca- vated in 2016. e8 Current Biology 31, 1–14.e1–e18, June 7, 2021 Please cite this article in press as: Yaka et al., Variable kinship patterns in Neolithic Anatolia revealed by ancient genomes, Current Biology (2021), https://doi.org/10.1016/j.cub.2021.03.050 ll Report Sk.1885 (burial feature 84, Level South M, Middle period, Building 50): the primary flexed burial of a male child. He was 7 years ± 2yrs at death, excavated in 1995. This individual was interred directly above Sk.2033 (see below) in the southwest corner of B.50. Radiocarbon dating places this individual between 6905–6885 cal BCE (1%) or 6825–6635 cal BCE (92%) or 6625–6600 cal BCE (2%) (Table Z2). Sk.2033 (burial feature 84, Level South M, Middle period, Building 50): the primary flexed burial of a male child 3 years ± 1yr at death, excavated in 1995. This individual was interred directly below Sk.1885 (see previous) in the southwest corner of B.50. Radio- carbon dating places this individual between 6690-6590 cal BCE (95%) (Table Z2). Sk.2017 (burial feature 96, Level South M, Middle period, Building 50): the primary burial of a female neonate (0-2 months at death based on measurements of the basi-occipital bone), excavated in 1997. The burial was located near the oven along the southern wall of B.50. The bones of this individual were scorched as a result of the burial’s proximity to the oven. Radiocarbon dating places this individual between 6815–6790 cal BCE (2%) or 6775–6595 cal BCE (93%) (Table Z2). Sk.2728 (burial feature 258, Level South M, Middle period, Building 50): an undisturbed primary burial of a female infant aged 9 months (±3 months) at death based on dental development. It was excavated in 1997 from Building 50, located in the South Area of the site. The body was placed in a small pit near the eastern wall of the main room. Radiocarbon dating of the petrous bone places this individual between 6695-6505 cal BCE (95%) (Table Z2). Sk.2779.1 (burial feature 265, Level South M, Middle period, Building 50): the primary burial of a male neonate (0-2 months at death based on measurements of the basi-occipital bone), excavated in 1997. The burial was heavily disturbed by Mellaart’s earlier exca- vations in this building during the 1960s. Sk.2842 (burial feature 274, Level South M, Middle period, Building 50): a disturbed primary burial of a female infant aged 18 months (±6 months) at death based on dental development. It was excavated in 1998 from Building 50, located in the South Area of the site. The body was placed in a small pit near the center of the main room and was partially disturbed by a later burial. Radiocarbon dating of the petrous bone places this individual between 6690-6505 cal BCE (95%) (Table Z2). Sk.21981 (burial feature 8153, Level South N, Middle period, Building 89): a disturbed primary burial of a female infant/child aged 3 years (±1 year) at death based on dental development. It was excavated in 2015 from Building 89, located in the South Area of the site. The body was placed in a small pit within the north platform of the main room and was subsequently truncated by the digging of a post retrieval pit. Sk.5747 (burial feature 1064, Level South M, Middle period, Building 91): a primary burial of a female infant aged 18 months (±6 months) at death based on dental development. It was excavated in 2002 from Building 91, located in the South Area of the site. The body was placed in a small pit located in the northeast corner of B.91. Radiocarbon dating of the petrous bone places this individual between 6640-6490 cal BCE (95%) (Table Z2). Sk.30006 (burial feature 7615, Level North G, Middle period, Building 114): a primary burial of a female infant aged 9 months (±3 months) at death based on dental development. It was excavated in 2015. The body was interred with a middle adult female in an oval pit along the south wall of the main room. Radiocarbon dating of the petrous bone places this individual between 6645–6495 cal BCE (94%) or 6490–6480 cal BCE (1%) (Table Z2). Sk.8587 (burial feature 1013), Level North G, Middle period, Building 114): a primary burial of a female neonate (0-2 months at death – based on long bone length) excavated in 2002 and located under the southeast platform. The burial was partially disturbed by subsequent burials in this location, and likely also by rodent burrowing. Sk.11739 (burial feature 1912, Level TP Q-R, Final period): a heavily disturbed set of human remains belonging to a middle adult (35-50 years of age-at-death) based on dental occlusal wear. The individual was assessed as a possible male based on cranial morphology, although aDNA suggested the individual was genetically female. These remains, potentially representing a secondary burial, were excavated in 2005 from Space 411, located in the TP Area of the site. Radiocarbon dating of the petrous bone places this individual between 6235-6075 cal BCE (95%) (Table Z2). Sk.20217 (burial feature 3931, Level TP Q-R, Final period?): a female child aged 6 years (±2 years) at death based on dental devel- opment. This individual, excavated in 2012, is one of three individuals recovered from burial feature 3931 in the TPC Area. The burial was badly damaged as it was found directly beneath the surface. Hence, it could not be associated with any Neolithic buildings or spaces. Its stratigraphic position indicates that it post-dates B.122 from the Late period, which implies it most likely comes from the Final period. However, this is not corroborated by radiocarbon dating of the petrous bone that places this individual significantly earlier, between 6415-6240 cal BCE (95%) (Table Z2). Description of Boncuklu Höyük individuals ZHAJ (Area H, Grave 27): this is a primary single inhumation of a middle adult female (as determined by aDNA) buried in a sub-oval cut. The individual was found lying tightly flexed on her left side, positioned east-west with the head toward the west and facing north. ZHAG and ZHAF (Area H, Grave 18): grave 18 contained a double inhumation of a middle adult female (ZHAF) and a perinatal infant (ZHAG) found in an oval cut larger than average. The adult (ZHAF) was found lying tightly flexed on her left side and positioned with a northwest-southeast orientation with the head toward the northwest. The perinate was articulated and found with the head on top of the adult pelvis. The female sex of the adult could be confirmed by ancient DNA.20 The sex of the perinate was determined as a female by aDNA, and it can be ruled out that ZHAF and ZHAG were first or second-degree related. Skeleton ZHAF has been radiocarbon dated to 8285–8175 cal BCE (83%) or 8115–8090 cal BCE (4%) or 8040–8010 cal BCE (8%) (Table Z2). ZHB (Area H, Grave 9): a single inhumation of an adolescent-young adult female. The sex of the individual has been confirmed by ancient DNA analysis.20 The individual was found lying on her right side/partially prone, in a semi-flexed position. The body was Current Biology 31, 1–14.e1–e18, June 7, 2021 e9 Please cite this article in press as: Yaka et al., Variable kinship patterns in Neolithic Anatolia revealed by ancient genomes, Current Biology (2021), https://doi.org/10.1016/j.cub.2021.03.050 ll Report orientated east-west with head to the east and facing northeast, and has been radiocarbon dated to between 8280–8165 cal BCE (57%) or 8120–7960 cal BCE (38%) (Table Z2). ZHF (Area H, Grave 14): single inhumation of an adult male buried in a sub-oval cut. The age-at-death of the individual was difficult to estimate accurately because both the skull and pelvis were highly fragmented. The sex has been confirmed by ancient DNA.20 The body was found lying on the left side and orientated northwest-southeast with the head orientated toward the northwest and facing northeast. The upper limbs were flexed at the elbow with the palms of the hands together and placed immediately in front of the face. The long bones were highly fragmented and animal burrowing had destroyed much of the skull, most of the axial elements and the feet. The skeleton has been radiocarbon dated to 8225–7940 cal BCE (95%) (Table Z2) ZHJ (Area H, Grave 15): this is a primary single old adult inhumation found in a sub-oval cut. The individual was found in a flexed position lying on its right side and positioned north-south with the head orientated toward the south. The bones were relatively well preserved compared with other graves, although burrowing animals had destroyed parts of the skull and axial skeleton, including the left foot. Morphological sex determination was difficult because the remains were gracile, probably as a result of the aging process. Ancient DNA analyses demonstrated that this individual was female. She has been radiocarbon dated to 8295–8240 cal BCE (95%) (Table Z2). ZHBJ (Area H Grave 30): single inhumation of a middle/old adult male in a suboval cut. Sex has been confirmed by ancient DNA.20 The individual was found lying tightly flexed on his right side, although it should be noted that there was considerable damage from bioturbation that disturbed much of the skeleton and destroyed most of the thorax and skull. The body was positioned east-west with the head toward the west, but the facing direction could not be ascertained due to the aforementioned disturbance. ZKO (Area K, Grave 12): this is a single inhumation of an old adult male in an oval cut. The individual was found lying tightly flexed on his left side and orientated east-west with the head toward the east. The bones were generally well preserved, but rodent burrowing activity caused significant disturbance of the ribs, scapulae and vertebrae. Sex was confirmed through aDNA analysis as male. ZMOJ (Area M, Grave 49): a primary but heavily disturbed burial of a young adult male (determined by aDNA) in a sub-circular grave. The individual was orientated east-west with head to the west and facing north. The skull was found at one end of the grave and many of the other bones had been moved by animal action, so their anatomical position was not maintained. Ancient DNA in- dicates that this individual was male. METHOD DETAILS Radiocarbon dating Radiocarbon measurements have been obtained on remains from a total of eighteen individuals, eight from Asxıklı Höyük and ten in- dividuals from Çatalhöyük as part of this study. Fourteen samples were dated at the TÜB_ITAK-MAM facility (Gebze, Turkey) in 2019, three at the Oxford Radiocarbon Accelerator Unit in 2009, 2016, and 2018, three at the Keck Carbon Cycle AMS Facility, University of California (Irvine) in 2014 and 2018, and three at Uppsala University in 2018. At TÜB_ITAK-MAM and Uppsala University samples ob- tained from petrous or rib bones of each individual were dated. At Oxford and Irvine samples were processed from lower limb bones (femora or tibiae). At TÜB_ITAK-MAM the human bone samples were gelatinised and ultrafiltered,113 graphitised114 and dated by AMS on a 1MV NEC Pelletron accelerator. At Oxford the samples were also gelatinised and ultrafiltered,115 graphitized,116 and dated by AMS.117 At Irvine samples were also gelatinised and ultrafiltered,113,118 combusted,119 graphitized,120 and dated by AMS.121 In Up- psala the samples were gelatinized,122 combusted and graphitized,123 and dated by AMS.124 The results are conventional radio- carbon ages125 and have been corrected for fractionation using d13C values measured by AMS. Two samples from Çatalhöyük (30006 and 5747) were dated at both the TÜB_ITAK-MAM facility and the Oxford Radiocarbon Accelerator Unit, and in both cases produced measurements that are not statistically different at the 5% significance level126 (Table Z2). The three individuals dated at Uppsala University were also dated at the TÜB_ITAK-MAM facility, again producing pairs of results that were not statistically different at the 5% significance level126 (Table Z2). Radiocarbon ages were calibrated using IntCal20127 and the probability method128 with ranges rounded outward to 5 years; repli- cate measurements have been combined by taking a weighted mean before calibration126 (Tables 1 and Z2). The remaining sample ages were inferred based on their archaeological context. Molecular biology laboratory methods Sample preparation and DNA extraction Sample preparation and DNA extraction were performed using two different protocols. In the first protocol, sample preparation, DNA extraction and library preparation from Asxıklı Höyük and Çatalhöyük samples were carried out in a dedicated laboratory for ancient DNA analysis at the Middle East Technical University (METU) (Ankara, Turkey). All necessary precautions to avoid contamination were taken during the sample grinding, DNA extraction and library preparation processes: tools and surfaces were regularly cleaned with bleach, RNase AWAY and long exposures with UV light in the aDNA laboratory. Samples were decontaminated and prepared as in:129 The outer surface of the samples were carefully removed and discarded using either single use blades or Dremel drill with single use cutting discs. Each side of a sample was irradiated with UV-light (254 nm wavelength, 12 V and a distance of 5 cm from the UV source) in a cross-linker for 30 min. The samples were ground into fine powder using a freezer mill. DNA extraction was performed from 120-200 mg bone powder using a silica spin column method following Dabney et al. (2013)130 with slight modifications from Ottoni et al. (2011).131 Briefly, bone powder from the inner part of petrous bones were digested in 1 mL extraction buffer (0.45 M e10 Current Biology 31, 1–14.e1–e18, June 7, 2021 Please cite this article in press as: Yaka et al., Variable kinship patterns in Neolithic Anatolia revealed by ancient genomes, Current Biology (2021), https://doi.org/10.1016/j.cub.2021.03.050 ll Report EDTA, 0.25 mg/mL of Proteinase K, pH 8.0) h by vortexing and leaving in a rotating shaker at 56 5C for 24 h and then 37 5C for another 24. The supernatant was then transferred to an extension reservoir (Zymo Research) and fully mixed with the 13 mL custom binding buffer (5 M guanidine hydrochloride, 40% Isopropanol, 90 mM sodium acetate and 0.05% Tween-20), which is fitted to MinElute sil- ica spin column (QIAGEN). First, extension reservoir -MinElute assembly was placed into a 50 mL falcon tube and centrifuged for 4 min at 1,500 x g, then rotated 905 and centrifuged for another 2 min at 1,500 x g. Collection tubes with MinElute spin column are centrifuged (dry spin) for 1 min at 3,300 x g followed by two washes with PE buffer (MinElute, QIAGEN). The DNA was then eluted twice in 50 mL of Elution Buffer (EB) (MinElute, QIAGEN) with 0.05% Tween-20 and centrifuged at 16,100 x g for 1 min to collect DNA. Two negative extraction controls accompanied every 8-10 samples. In the second protocol, one sample (21981) from Çatalhöyük was processed in the laboratory dedicated to ancient DNA analyses, at the Institute of Human Biology and Evolution, at the Adam Mickiewicz University in Poznan (AMU) (Poland). Similar precautions to avoid contamination were taken as in the METU laboratory. In addition, prior to DNA extraction, the sample was cleaned with 2% NaOCl and rinsed with sterile water. After cleaning, the sample was UV irradiated for at least one h on each side. Following UV irra- diation, the petrous bone was cut in half and drilled with the single use Dremel cutting disc and drill bit. Then DNA was extracted from 150 mg of bone powder following a silica-based method developed by Yang et al.132 with modifications introduced by Svensson et al.133 Briefly, the bone powder was digested in 1.5 mL extraction buffer (0.4 M EDTA, pH 8.0), 1 M Urea and 15 ml of Proteinase K) for 24 h in a rotating shaker at 565C. The obtained solution was than concentrated to 100 mL using Amicon Ultra-0.5 Centrifugal Filters. The DNA was then extracted from the concentrated solution using QiaQuick PCR purification kit (QIAGEN) following the manufacturer protocol, where final elution was performed twice in 55 mL of EB buffer. UDG-treatment was not applied on any sample. Library preparation and initial sequencing Double-stranded DNA libraries were prepared using 20 mL of DNA extract using blunt-end ligation method following Meyer et al. (2010)134 with modifications as in Günther et al. (2015).135 Each library was amplified via PCR in six replicates, each in a total volume of 25 ml, using specific indexing primers (15 single- and seven double-indexing) (Table Z1). Negative controls were included in both the library preparation and PCR steps. Each reaction contained 3 mL DNA library and the following in final concentrations; 1X Am- pliTaq Gold Buffer, 2.5 mM MgCl2, 250 nM of each dNTP, 2.5U AmpliTaq Gold (Life Technologies), and 200 nM each of the IS4 primer and an indexed P7 primer. The cycling conditions were 94 C for 10 min followed by 10-14 cycles of 94 C for 30 s, 60 C for 30 s, 72 C for 45 s and a final extension at 72 C for 10 min. Amplified libraries were pooled and purified with AMPure XP beads (Agencourt). The libraries were quantified on a 2100 Bioanalyzer using the High Sensitivity DNA Kit (Agilent Technologies) or on Tapestation 2200 (High Sensitivity D1000 ScreenTape). None of the extraction blanks or PCR blanks showed presence of DNA and were therefore not sequenced. Libraries were pooled in equimolar concentrations (final vol of 10 nM total pool) for the initial sequencing (prescreening) process and sequenced on Illumina HiSeq 2500, HiSeq X and NovaSeqS4 platforms at SciLife, Stockholm, with 100-150 bp paired- end reads on single or several lanes. Libraries that yielded sufficient reads from the initial screening process were then sequenced deeper in pools of three to six libraries per lane. Whole genome in-solution capture and resequencing To increase the depth of coverage, the best libraries of 11 individuals (Table Z1) -in terms of human DNA proportions in the prescre- ening data- we enriched for human genomic DNA using the MYbaits Human Whole Genome Capture Kit (African baits) from Arbor Biosciences (Ann Arbor, MI) following the manufacturer’s instructions (http://www.mycroarray.com/pdf/MYbaits-manual-v4.pdf). PCR was performed for each captured library at 16-19 cycles with primers IS5 (5¢AATGATACGGCGACCACCGA) and IS6 (5¢ AAGC AGAAGACGGCATACGA) using either Herculase II Fusion DNA Polymerase (Agilent Technologies) or KAPA HiFi HotStart Polymerase (Kapa Biosystems). Captured libraries were purified with AMPure XP beads and quantified on the Bioanalyzer 2100 using the High Sensitivity DNA Kit (Agilent Technologies). Purified libraries were pooled in equimolar concentrations and sequenced on Illumina Hi- seq 2500 and Hiseq X platforms at SciLife, Stockholm, with 100-150 bp paired-end reads on one or several lanes. The enrichment procedure increased human DNA endogenous proportions by 1.23 273 (median 83 ) (Table Z1). QUANTIFICATION AND STATISTICAL ANALYSIS Sequence read processing We processed sequencing data from each library as described in Kılınç et al.20 We trimmed the residual adaptor sequences in FASTQ files and merged the paired-end sequencing reads using MergeReadsFastQ_cc.py136 or AdapterRemoval,137 with an overlap of at least 11 bp between the pairs. We mapped the merged reads with single-ended mode to the human reference genome (version hs37d5) us- ing BWA aln (version 0.7.15)138 with the parameters ‘‘-n 0.01 -o 2’’ and disabled the seed with ‘‘-l 16500’’139,140. We merged different libraries of the same individual and removed PCR duplicates, collapsing the reads with identical start and end positions using FilterUniqueSAMCons.py.136 Finally, we filtered the reads shorter than 35 bp length and more than 10% mismatches to the human refer- ence genome.20 We also remapped published ancient data from Table Z3 following the same procedures for comparative analysis. Authentication of data, contamination estimates and molecular sex determination We estimated the authenticity and level of contamination in the ancient genomes using three different approaches: (a) studying the post-mortem damage (PMD) patterns that are characteristic of ancient DNA, (b) checking for mtDNA contamination based on the presence of heterozygous sites, and (c) ruling out X chromosome contamination in male individuals. Current Biology 31, 1–14.e1–e18, June 7, 2021 e11 Please cite this article in press as: Yaka et al., Variable kinship patterns in Neolithic Anatolia revealed by ancient genomes, Current Biology (2021), https://doi.org/10.1016/j.cub.2021.03.050 ll Report Postmortem damage We assessed the authenticity of all samples from As xıklı Höyük (n = 8) and Çatalhöyük (n = 14) by estimating aDNA-specific damage patterns represented by high frequency cytosine to thymine (C to T) transitions at 5¢ ends of reads, and guanine to adenine transitions at the 3¢ ends. We used PMDtools141 to evaluate the frequency of PMDs at the first 30 positions at the 5¢- and 3¢ ends of the reads. All individuals’ libraries showed > 25% PMD at 5¢- and 3¢ ends (Figure S1A; Table Z1). Mitochondrial contamination We calculated mitochondrial DNA (mtDNA) contamination of all samples from As xıklı (n = 8) and Çatalhöyük (n = 14) using contamMix (version 1.0.10).142 This method calculates posterior probability of mtDNA contamination using a Bayesian approach. We called a consensus mtDNA sequence for each individual from BAM files using samtools mpileup (version 1.9)143 and vcfutils modules. Then, the consensus sequences were added to a set of 311 modern human mtDNA sequences and mapped to these 311 modern human mtDNA sequences. Here, we calculated contamination rates with and without transitions using contamMix. Authenticity was estimated at 393% for all 22 libraries (Table Z1). X chromosome contamination X chromosome contamination was estimated for the male individuals from As xıklı (n = 1) and Çatalhöyük (n = 4) using ANGSD.144 We generated a binary chrX BAM file with the following parameters ‘‘-r X:5000000-154900000 -doCounts 1 -iCounts 1 -minMapQ 30 -minQ 30’’ for X chromosome positions. Then, we ran the contamination.R script to estimate chrX contamination using Fisher’s exact test and the jackknife procedure (Table Z1). Overall evaluation of aDNA authenticity Evaluating the above results together, we confirmed that all n = 22 individuals examined passed at least two of the contamination estimation methods.108 Given these results, we included all samples in further analyses. Molecular sex determination To assess the molecular sex of all individuals, we calculated the ratio of reads mapping to the Y chromosome to mapping to both X and Y chromosomes using the Ry method as described in (Skoglund et al., 2012, 2013)145,146 with mapping quality of at least 30. One Asxıklı and four Çatalhöyük individuals were identified as males. Seven Asxıklı and ten Çatalhöyük individuals were assigned as females. Our molecular sexing results are consistent with the osteological analysis (Table Z2). Mitochondrial DNA and Y chromosome analyses Mitochondrial DNA We obtained mitochondrial genomes with mean coverages between 0.4- and 258-fold per individual (Table Z1). In order to assess the mitochondrial haplogroups, we called consensus mitochondrial sequences of each individual using samtools (version 1.9) mpileup and variant caller tools143 with parameters set for aDNA; namely, filtering for sites that have a minimum depth of 3 and a base and mapping quality score of at least 30.147 We assigned mtDNA haplogroups of each individual based on SNPs at informative nucleotide positions of the mitochondrial genome using HaploGrep2v2.1.1 (https://haplogrep.i-med.ac.at/).148 The results are presented in Table Z2 and Figure S1E. We observed haplogroup K1a4, one of the common haplogroups in Neolithic farmer populations,149 in three individuals from Asxıklı (128, 129, 133). Two As xıklı individuals (131, 136) belonged to T2c1a and the remaining three individuals from Asxıklı (2, 33, 40) belonged to haplogroups H2a2a, U3a and N1a1a1, respectively. We also found hap- logroup K1a4 in one Çatalhöyük individual (30006) and a subtype of haplogroup K1 (K1a) in three individuals (2728, 2842, 1885). Three Çatalhöyük individuals (21981, 11739, 20217) belonged to three subtypes of K1 (K1a17, K1b1, K1a4b), respectively. Three individ- uals from Çatalhöyük (8587, 2017, 5747) belonged to subtypes of T2 (T2e, T2, T2c1) and one (5357) belonged to N1a1a1, one of the most abundant haplogroup in Near Eastern and European farmer populations.149,150 The remaining Çatalhöyük individuals (2033, 2779, 21855) belonged to subtypes of H2a2a (H2a2a1d, H2a2a, H2a2a1), respectively. Y chromosome We used the yHaplo program (version 1.0.19)151 to assign Y chromosome haplogroups of one As xıklı and four Çatalhöyük male individuals. We genotyped each male individual based on 13,508 ISOGG (International Society of Genetic Genealogy, http://isogg.org, version 11.04) consortium SNPs, excluding strand-ambiguous SNPs (C/G and A/T) and by randomly choosing one allele for each of 13,508 ISOGG SNPs. We called all single base substitutions using BAM files mapped to hs37d5 and samtools mpileup (version 1.9)143 (filtering the sites with a mapping quality and a base quality of lower than 30. We also excluded insertions/deletions and sites that displayed multiple alleles. We observed haplogroup G2a2b in As xıklı33 male individual. Two individuals from Çatalhöyük (5357 and 2779) were assigned to haplogroup C1a2 and the remaining two Çatalhöyük individuals (1885 and 2033) belonged to haplogroups, G2a2a1 and H3a1, respectively (Table Z2). Dataset processing Reference SNP datasets We prepared three datasets by merging the ancient genomes generated in this study (n = 22) with published ancient genomes from previous studies (n = 191; Table Z3) and with different datasets of modern-day populations: DS1: The Human Origins SNP Array dataset25,139 that includes 594,924 autosomal SNPs (both transitions and transversions) gen- otyped in 2,730 modern-day individuals from 203 populations. This SNP list was used for PCA and ADMIXTURE analyses. When gen- otyping using DS1, transitions were included only conditionally (see ‘Genotyping’ below) to avoid the influence of postmortem damage. e12 Current Biology 31, 1–14.e1–e18, June 7, 2021 Please cite this article in press as: Yaka et al., Variable kinship patterns in Neolithic Anatolia revealed by ancient genomes, Current Biology (2021), https://doi.org/10.1016/j.cub.2021.03.050 ll Report DS2: The 1000 Genomes whole genome sequencing dataset (phase 3)152 comprised of 1,938,919 biallelic autosomal transversion SNPs genotyped in West African Yoruba (YRI) individuals (n = 108) was used to maximize the genetic overlap between ancient sam- ples and reduce the potential effect of post-mortem damage. The dataset was prepared by extracting all transversion SNPs and choosing alleles with minor allele frequency 310% in Yorubans to avoid the effect of Eurasian admixture into Yorubans, as described in (Günther et al., 2015; Kılınç et al., 2016).20,135 This dataset was used for outgroup f3 and D-statistics, FST estimation, ROH analysis and also for kinship estimation analysis. For qpAdm analyses, we merged DS2 with SGDP v4153 (Simons Genome Diversity Project, downloaded from https://reichdata.hms.harvard.edu/pub/datasets/sgdp/) by overlapping 1,479,034 SNPs. DS3: X chromosome SNPs from the 1000 Genomes whole genome sequencing dataset version (phase 3)126 that were genotyped in West African Yorubans were extracted and those with minor allele frequency 310% were chosen (across n = 56 female and n = 52 male Yoruba individuals). We also removed pseudoautosomal regions from X chromosomes as described in the human reference genome (hs37d5). We included only transversion SNPs in this dataset. The resulting 73,799 SNP list was used for X chromo- some-based kinship estimation. Genotyping For each of the described SNP datasets, we genotyped ancient individuals at each SNP using reads with minimum base quality and mapping quality of 30. We pseudohaploidized our data, such that when multiple reads overlapped with the same SNP we randomly selected one read and this position was assumed to be homozygous in the ancient individuals.20,154 We removed the non-biallelic sites, transitions and in- dels including the sites that were found in an ancient individual but not in the reference data. To avoid the influence of postmortem damage, whenever we encountered a T or an A when the reference genome carried a C or a G, respectively, we coded that position as missing in the ancient genotype, following.20,135 For kinship estimation using NgsRelate we used the ANGSD program (see section ‘NgsRelate analysis’ below). Population genetic analyses In all population genetics analyses we excluded related individuals, by choosing the individual with the highest genome coverage among groups of closely related individuals (> 3rd degree). Principal components analysis We carried out principal component analysis (PCA) as a first assessment of the genetic affinities of the newly generated genomes from Asxıklı and Çatalhöyük following.20 First, we conducted PCA using a total of 49 modern-day West Eurasian populations from the Human Origins SNP Array dataset25,139 and projected the 136 ancient individuals (114 previously published and 22 reported in this study) onto the first two principal components inferred from modern individuals. The list of modern-day populations is pre- sented in Figure S3B. For this, the smartpca program in the EIGENSOFT package155 was used with the parameters ‘‘numoutlieriter:0’’ and ‘‘lsqproject:YES’’. We used dataset DS1 for Figure 1B. We further repeated the PCA also using transversion SNPs only (Figure S3C). f3- and D-statistics To investigate pairwise genetic affinity between populations or between individuals, we computed outgroup f3-statistics using DS2 (autosomal data) with the qp3Pop program in the ADMIXTOOLS package.25 This quantifies shared drift between individuals/popu- lations as their divergence from an outgroup population.25 The calculation was performed at both the individual and the population levels. The Yoruba (YRI) population from 1000 Genomes Project phase 3152 was used as an outgroup. To study population-level similarities, we converted f3-statistics into a pairwise distance matrix by subtracting all values from 1; we then summarized this distance matrix on two dimensions using multidimensional scaling (MDS) with the ‘cmdscale’ function in the R ‘stats’ package (http://www.r-project.org/) (Figures 1C and S2A). We computed the MDS goodness of fit by calculating a new dis- tance matrix from the MDS output and calculating its Pearson correlation coefficient with the original distance matrix. These outgroup f3-statistics were used for 3 different purposes: (a) studying inter-population relationships (Table Z5), (b) comparing inter-individual genetic diversity within populations (see below) (Table Z8), (c) studying correlation between burial location and genetic distance. We calculated D-statistics for two purposes. First, we tested whether pairs of individuals from a Neolithic site systematically formed clades (showed a higher degree of allele sharing with each other) relative to individuals from other sites (Table Z7; Figures S3D–S3F). Second, we tested population-level affinities between and among Neolithic Anatolian populations (all individuals sampled from a site) and other broadly contemporaneous populations and to infer admixture events (Tables Z3 and Z4). For D-tests we used the program qpDstat in the ADMIXTOOLS package, and used the Yoruba population as outgroup. Statistical significance and the confidence intervals were estimated using the block-jackknife procedure by ADMIXTOOLS. Confidence intervals shown in plots display ± 2 standard errors from the mean. We used a cutoff of |Z|33 for nominal statistical significance but did not apply multiple testing correction, due to the descriptive nature of the analyses. We conducted additional individual-level D-statistics (a) only using shotgun data for Boncuklu to avoid the influence of technical biases that may arise due to use of capture and shotgun data, (b) comparing only Boncuklu and As xıklı Höyük data to directly test possible structure within Aceramic Central Anatolia (Figures S3E and S3F). Technical influence on f3-statistics Because our dataset includes genomic data produced by different laboratory procedures, including shotgun sequencing and 1240K SNP capture, we explored the possible influence of technical effects on outgroup f3-statistic estimates, taking advantage of the fact Current Biology 31, 1–14.e1–e18, June 7, 2021 e13 Please cite this article in press as: Yaka et al., Variable kinship patterns in Neolithic Anatolia revealed by ancient genomes, Current Biology (2021), https://doi.org/10.1016/j.cub.2021.03.050 ll Report that our dataset contained both types of data for individuals from Boncuklu,20,21 and that Boncuklu Höyük shows high genetic ho- mogeneity within the settlement (see below). We found that f3-statistics that include pairs of individuals with genomic data produced using alternative procedures are only slightly lower than f3-statistics that include pairs of individuals produced using the same pro- cedure, when autosomal data is included (Figure S1D). On the other hand, calculating the same statistics with X chromosomal data, we observed a conspicuous technical effect (Figure S1D). Accordingly, we did not analyze X chromosomal genetic diversity in the following analysis. Within-group genetic diversity comparisons We analyzed genetic diversity differences among groups, either comparing (a) populations, represented by all individuals sampled per settlement, or (b) subsets of individuals from specific phases of settlements. Diversity per group was calculated as the mean of 1- f3 (see above) among all members of a group (Table Z8). To test the statistical significance of differences in diversity between 2 groups, we used a random permutation test. Specifically, to calculate the null distribution for the diversity difference between 2 groups, we permuted group membership randomly using the R ‘‘sample’’ function, we then calculated the mean of 1- f3 values among all members of each pseudogroup, and calculated the absolute difference of these means (Table Z9). This was repeated 10,000 times to create a null distribution. Finally, we compared the observed absolute mean diversity differences to the null expectation, yielding an empirical P-value for each pair of compared groups. Note that permutation tests can be convenient for testing null hypotheses of no difference between groups, but they are also conservative because the null distribution can include the observed difference espe- cially when the sample size is small. ADMIXTURE analysis We performed unsupervised genetic clustering using ADMIXTURE24 software to estimate ancestry components in ancient genomes produced in this study. We used present-day Eurasian, African, Asian, and American groups’ genotype data from the Human Origins dataset (n = 231)25,139 and merged this with the ancient individuals’ genotypes. We filtered the dataset by pruning for linkage disequi- librium using PLINK156 with the parameters ‘‘–indep-pairwise 200 25 0.4’’ and for missing genotype with ‘‘-geno 0.99’’, leaving 518,401 SNPs to be analyzed. We conducted ADMIXTURE analysis for each value of K ranging from 2 to 15 and determined the clus- ters of each ancient individual using the ‘‘projection’’ function of ADMIXTURE. We visualized the results using PONG software.157 FST estimation We computed pairwise FST to evaluate genetic differentiation among early Holocene populations from Anatolia, Levant and Iran. Pop- ulation-level FST were calculated for ancient population samples that included at least two ancient individuals - the same criterion as used for f3-statistics-based population comparisons. The smartpca program in the EIGENSOFT package155 was used with default parameters ‘‘inbreed:YES’’ and ‘‘fstonly:YES’’, and with DS2 (autosomal data). We visualized the results on two dimensions using multidimensional scaling (MDS) with the ‘cmdscale’ function in the R ‘stats’ package (http://www.r-project.org/) (Figure S2B; Table Z6). qpWave/qpAdm admixture analysis We modeled target Anatolian Ceramic period populations (Çatalhöyük and Barcın) as admixture between two or three source pop- ulations using the qpWave (v1200) and qpAdm (v1201)158 programs in ADMIXTOOLS (v7.0),25 with the option ‘‘allsnps: YES.’’ We used a basic set of 12 outgroups as ‘‘right populations,’’ which included the present-day individuals (n = 28); Mbuti,153,159 Han,153,159 Papuan,159–161 Onge,153 Chukchi,153 Mixe,153,159 as well as the ancient individuals (n = 24); Kostenki14,162 Mal’ta,162 Vil- labruna,162–164 Natufian,108 Caucasian hunter-gatherers (CHG)162,163 and Pınarbasxı21 (collectively referred to as ‘‘Base’’ in Table Z10). These outgroups were chosen by considering their geographical remoteness, and lack of recent backflow from the selected target and source populations.21,165 Our source populations were Anatolian Aceramic (Asxıklı or Boncuklu), Levant Neolithic and Iran Neolithic, which were used as ‘‘left populations’’ (Table Z10). We used a significance level threshold of p = 0.05 to reject models for both qpWave and qpAdm analysis. Results of qpWave showed that neither the Asxıklı versus Boncuklu populations could be distinguished from each other, nor Çata- lhöyük versus Barcın populations (p > 0.01), a result expected given their similarities observed in other analyses (e.g., MDS). We could model the latter Ceramic Neolithic populations (Çatalhöyük or Barcın) as mixtures of Aceramic Neolithic (Asxıklı or Boncuklu) and Levant Neolithic (P-value > 0.05; Table Z10). However the fit was poor when we tried to model Ceramic Neolithic populations (Çata- lhöyük or Barcın) as mixtures of Aceramic Neolithic (Asxıklı or Boncuklu) and Iran Neolithic (mixture proportions > 1 and/or P-value < 0.05). Thus, in a second round of analyses, we tested whether CHG could be a better proxy for a possible eastern source of gene flow. For this we removed CHG from the ‘‘right populations’’ list and used it instead of Iran Neolithic among the ‘‘left populations’’ (Table Z10). This likewise produced poor fits. Estimating genetic relatedness and pedigree relationships Overview of kinship analyses xıklı and Çatalhöyük individuals and previously published Anatolian Neolithic We first inferred relatedness coefficients for pairs of As individuals. For this we used three different software, NgsRelate,35 lcMLkin,36 and READ,37 as described below. NgsRelate and lcMLkin infer the genetic kinship coefficient (q) between a pair of individuals, i.e., the probability that a pair of randomly chosen alleles from two individuals each are identical-by-descent (IBD). For this they first estimate k0, k1, k2 (Cotterman coefficients), which are the probabilities of sharing 0, 1 and 2 alleles IBD between a pair of individuals, such that k0 + k1 + k2 = 1. The kinship coefficient q is then calculated as q = k1 / 4 + k2 / 2. READ uses an alternative approach, described below. All 3-software produced consistent results. e14 Current Biology 31, 1–14.e1–e18, June 7, 2021 Please cite this article in press as: Yaka et al., Variable kinship patterns in Neolithic Anatolia revealed by ancient genomes, Current Biology (2021), https://doi.org/10.1016/j.cub.2021.03.050 ll Report We restricted the kinship analyses to estimates of 1st-3rd degree and to a minimum threshold of 5,000 overlapping SNPs between a pair of individuals. This was based on the empirical observation that the software sometimes estimated non-0 kinship coefficient values for pairs of individuals with < 5,000 SNPs overlapping between them, and who could not possibly be genetically close rela- tives. For instance, NgsRelate calculates the kinship coefficient (q) between As xıklı 2 and Barcın M10_352, sharing 3,044 SNPs, as 0.02, suggesting a 4th-5th degree relationship, despite the pair being separated by c.1,000 years, i.e., about 40 generations (Fig- ure S1B; Table Z11). In another example, the kinship coefficient calculated by NgsRelate between Asxıklı 2 and Asxıklı 40 was esti- mated as 0.71 by NgsRelate, both with low quality data and sharing 1,662 SNPs, suggesting an inbred 1st degree relationship pairs, despite more than 300 year between two individuals (Figure S1B; Table Z11). All analyses were run on the autosomal transversion dataset DS2 and using BAM files as input data for all three software. In addi- tion, we also implemented NgsRelate on DS3 to estimate X chromosomal kinship coefficients. NgsRelate analysis NgsRelate software (version 2)35 is designed to work efficiently on low-coverage genomic data, and uses genotype likelihood esti- mates instead of genotype calls. It also uses background population allele frequencies in q estimation, which is based on maximum likelihood using expectation maximization. According to Hanghøj and colleagues, it accurately estimates genetic relatedness be- tween pairs of individuals down to 5th degree (e.g., second-degree cousins). Importantly the software also estimates the inbreeding coefficient per individual simultaneously, which distinguishes it from lcMLkin. We ran NgsRelate using BAM files as input with default parameters. We used genotype likelihoods calculated by the ANGSD pro- gram144 with population allele frequencies calculated from n = 60 Anatolian early Holocene individuals (Tables Z2 and Z3). We computed ten replicate runs for each biologically related pair using autosomal data (Figure 2B). lcMLkin analysis lcMLkin36 also implements a maximum likelihood approach with expectation maximization, uses genotype likelihoods and popula- tion allele frequencies. The authors suggest it can accurately estimate genetic relatedness down to 5th degree (e.g., second-degree cousins) in low-coverage data. As opposed to NgsRelate, lcMLkin assumes no inbred individuals. We ran lcMLkin with population allele frequencies calculated from n = 60 Anatolian early Holocene individuals (Tables Z2 and Z3) including the newly generated data (n = 22) and using default parameters. READ analysis As a third approach, we used the software READ37 which applies a non-parametric approach to estimate biological kin-relationship between pairs. READ calculates and normalizes the mismatch rate (non-matching alleles, P0) in non-overlapping windows of 1 Mbps across the whole genome using pseudo-haploid data. READ uses this value to infer the degree of relationship (first degree as imme- diate family; parent-offspring and siblings, and second degree as extended family; cousins, uncles/aunts, grandparent-grandchild, and half-siblings), but cannot detect more distant relatives than estimating relatedness down to 3rd degree. READ compares the P0 distribution of each pair to those average unrelated pairs. We implemented READ on each population separately, i.e., with all individuals from each Anatolian Neolithic site as background, with default parameters. For each pair, we used normalized 1-P0 values as a proxy for the kinship coefficient (q), shown in Figure 2A. Here, normalization is done using the median P0 across all pairs, which represents the mismatch level of an average unrelated pair. The effect of population background on q estimates In NgsRelate and lcMLkin analyses we used all 60 Anatolian Neolithic individuals (Tables Z2 and Z3) to calculate population allele frequencies. Here, the relatively high genetic homogeneity of As xıklı Höyük and Boncuklu Höyük relative to the 3 Ceramic Neolithic sites (Figure 1D) could theoretically lead to overestimation of q among pairs from Asxıklı Höyük and Boncuklu Höyük. However, we do not expect that the magnitude of this effect could create artificially high q values consistent with 1st degree relatedness. In addi- tion, in READ analysis we used each site’s population as background, and the consistency among results of the 3 software suggests that high genetic homogeneity of Asxıklı Höyük and Boncuklu Höyük does not confound the results. Pedigree relationships In addition to the genetic relatedness level, we further inferred the most likely pedigree relationship between close relatives. This is a more challenging task because the Cotterman coefficient estimates from aDNA data are highly noisy, as evident from our simulations. This is not surprising as our genome coverages rarely exceed 1X, while Cotterman coefficients describe the probabilities of IBD across 4 alleles of 2 individuals at diploid loci. We therefore used multiple sources of information in combination: Cotterman coeffi- cients, the ratio between X chromosomal q and autosomal q, the anthropometric age-at-death estimates, radiocarbon dates, and mitochondrial and Y chromosomal haplotype information. We further used pedigree simulations to best assess the results. Biological kinship estimation on the X chromosome We estimated the kinship coefficient from X chromosome loci in order to distinguish different pedigree relationships (e.g., siblings, mother-son, father-daughter) among putative first-degree pairs (Tables S1, S3 and Z11). For this, we used NgsRelate software35 and X chromosome SNP data from 1000 Genomes genotyped in African Yorubans, following the same method described in previous sections. We restricted the X chromosome-based kinship estimates to a minimum threshold of 800 overlapping SNPs between a pair of individuals. We then compared the ratio between autosomal and X chromosome q for each pair. Testing mtDNA homogeneity for resolving pedigree relationships We tested mtDNA homogeneity for estimating pedigree relationships among Boncuklu Höyük individuals using pairwise mismatch rate of mtDNA sequences, since the Boncuklu Höyük population is genetically homogeneous. For this, we called consensus mtDNA sequences using the method described earlier and calculated the pairwise mismatch rate between mtDNA consensus sequences of Current Biology 31, 1–14.e1–e18, June 7, 2021 e15 Please cite this article in press as: Yaka et al., Variable kinship patterns in Neolithic Anatolia revealed by ancient genomes, Current Biology (2021), https://doi.org/10.1016/j.cub.2021.03.050 ll Report each individual pair following.135,141 We find that both first-degree related Boncuklu Höyük pairs, despite sharing the same mtDNA haplogroup with other Boncuklu Höyük individuals, have the lowest mismatch rates (Table Z14). This suggests they might actually share the same haplotype and the observed mismatches could be attributed to sequencing error. If so, combined with the other ev- idence (Tables S2, S3 and Z14), we infer the most likely pedigree relationship for the Boncuklu ZHF-ZHJ pair as mother-son. Goodness-of-fit tests We performed goodness-of-fit tests on contingency tables for Figure 2D and for the data in Table Z13, using a two-sided Fisher’s exact test as implemented in the R ‘‘stats’’ package. For testing the frequency of sisters in Neolithic Anatolia versus Bronze Age Eu- rope (reported by Mittnik and colleagues), we grouped all reported first-degree related pairs as ‘‘sisters’’ versus non-sisters, and con- ducted a single test on this 2x2 contingency table. We focused on sisters as we reasoned that sister co-burials (especially adults) could inform us most about sex-biased mobility or burial traditions. Inferring phenotypic traits and inbreeding for Asxıklı-128 Phenotypic traits We analyzed a number of functional SNPs (e.g., lactose tolerance, skin pigmentation, eye color) in the high coverage genome of Asxıklı-128. We restricted the analysis to this one individual with the highest coverage (53 ) to avoid excessive amounts of missing data. SNPs associated with phenotypes of interest were called from the BAM file using the samtools mpileup function143 and filtering with a mapping quality and a base quality lower than 30, as described in van de Loosdrecht et al. (2018).166 We retrieved the alleles associated with predicting skin, eye and hair color166 and computed the probability of skin, eye and hair shade for the As xıklı-128 in- dividual using the tool HIrisPlex (http://hirisplex.erasmusmc.nl/). Probabilities of 0.968, 0.019 and 0.009 for having intermediate, very pale and pale skin color were obtained respectively, including a high probability of having light hair color (> 0.99). Regarding the eye color prediction, probabilities of 0.547, 0.338 and 0.115 were obtained for brown, blue and intermediate color, respectively. We further analyzed derived allele variants in the MCM6 gene associated with lactose tolerance in Europeans (rs4988235),167 Af- ricans (rs41456145, rs145946881)168,169 and Middle Easterners (rs41380347)168,169 for the As xıklı-128 individual. Asxıklı-128 shows a homozygous ancestral genotype for these SNP positions, as reported in previous studies that propose the appearance of the lactose tolerance allele much later than the Neolithic.23,170 Thus, Asxıklı-128 individual was likely lactose intolerant and could not digest milk as an adult. Runs of homozygosity We analyzed runs of homozygosity (ROH) in As xıklı-128, the ancient genome with relatively high genome coverage produced in this study, and also six other relatively high coverage (> 53 ) ancient individuals with published data: ZHB (Bon002), Bar8 (M10-106), Loschbour, Stuttgart, NE1 and WC1 (Table Z3), following Kılınç et al.20 First, we performed diploid genotype calling with DS2 (auto- somal transversions data) using samtools mpileup,143 which generated between 1,798,444 and 1,893,648 transversion SNPs for these seven individuals. We estimated the distribution of ROH using PLINK (v. 1.9)156 with the parameters ‘‘–homozyg,–homozyg- window-snp 50,–homozyg-window-het 1,–homolog-windowsthreshold 0.05,–homozyg-snp 50,–homozyg-kb 500,–homozyg-den- sity 50,–homozyg-gap 100’’. We next calculated the genomic inbreeding coefficient using the FROH to estimate the level of inbreeding. FROH measures the in- dividual homozygosity which is the proportion of the genome covered by ROH.171,172 We calculated FROH by dividing the summed length of ROH (31.5 Mb) for each individual by the total length of autosomal chromosomes covered by SNPs in megabases. The re- sults are presented in Figure S3G and Table Z15. Estimating the expected ranges for kinship coefficients using simulations In order to estimate the expected ranges for the kinship coefficient (q) and Cotterman coefficients (k0, k1, k2) given noisy data, we performed a set of simulation experiments that we describe here. This is especially important when inferring genetic kinship with ancient genomes due to large and highly variable quantities of missing information. Thus, to investigate the uncertainty in the inferred kinship and Cotterman coefficients based on limited data, we simulated multiple pedigrees (Figure S4C) using both autosomal and X chromosomal data and with realistic degrees of sampling error, and studied the distribution of the aforementioned parameters across each degree of interest in an attempt to approximate their boundaries. For simulations, we used the modern-day Tuscany individuals (TSI) from the 1000 Genomes phase 3 dataset152 as a source to generate pedigrees (n = 107). First we extracted both autosomal and X chromosomal SNP data that were genotyped in these Tuscany individuals from the 1000 Genomes Project phased VCF files (phase 3).152 To prepare the autosomal dataset, we filtered SNPs by pruning for linkage disequilibrium with parameters ‘‘–indep-pairwise 100 25 0.4’’ and selection those with a minor-allele frequency (MAF) > 0.05 with ‘‘–maf 0.05’’ using the PLINK tool.156 We then retained only autosomal SNPs with known sex-specific genetic map- ping positions from Bhe rer et al.,173 thus resulting in a total of 157,172 biallelic SNPs. For the X chromosomal dataset, we used ‘‘–maf 0.05’’ filtering and removed pseudoautosomal regions from X chromosomes as described in the human reference genome (hs37d5),174 therefore ensuing a total of 179,716 SNPs. Second, we generated VCF files for each pedigree using these autosomal and X chromosomal datasets, using either the ped-sim software175 or our in-house Python 3.8176 library (available at https:// github.com/CompEvoMetu/kinshipsim), respectively. Next, we analyzed simulated data using NgsRelate software (version 2)35 to estimate kinship relationships. We finally merged the results generated by NgsRelate on the simulated pedigrees to produce the dis- tributions of the kinship statistics. We chose NgsRelate for these simulation experiments because its results were generally consis- tent with the lcMLkin and READ, and it has the further advantage of being able to co-estimate kinship and inbreeding.35 e16 Current Biology 31, 1–14.e1–e18, June 7, 2021 Please cite this article in press as: Yaka et al., Variable kinship patterns in Neolithic Anatolia revealed by ancient genomes, Current Biology (2021), https://doi.org/10.1016/j.cub.2021.03.050 ll Report The recombination of genetic information for autosomes was realized via the Housworth and Stahl crossover interference model177 and the ped-sim algorithm (with parameters ‘‘–intf interfere/nu_p_campbell.tsv178 –miss_rate 0–keep_phase’’) using the genetic map- ping data as described above. Because the available version of ped-sim was designed for autosomal simulations, we simulated the X chromosome using in-house code. The molecule inherited from the mother was generated through the following recombination pro- cess: the creation of a gamete, a haploid molecule to be inherited by the offspring, began with the random selection of three points (i.e., SNP locations) on the mother X chromosome -thus dividing it into four random-sized segments. Each segment of the gamete was obtained by randomly selecting that region from one of the two molecules from the parent (i.e., one of the haplotypes in the VCF), creating a haploid genotype. While sons only possess the single molecule inherited from the mother, daughters also receive a single- copy X chromosome from their fathers (Figure S4D). The autosomal investigation focused on first-, second- and third- degree relationships -from which inbred individuals were excluded- as well as unrelated pairs. We generated one hundred independent pedigrees, ensuring sample sizes of 3,500 (first degree), 3,200 (second degree), 2,000 (third degree), 15,600 (unrelated) as well as 700 (siblings), 2,800 (parent-offspring), 800 (half-siblings) and 800 (avuncular, i.e., aunt/uncle-niece/nephew). Before studying properties of their distributions, sample sizes were equalized by random selection. Estimates of q, k0, k1 and k2 were computed for different SNP sets: (a) The full set of 157,172 SNPs, (b) 5,000 randomly chosen SNPs to inform on the lower limit, (c) Randomly chosen SNPs (smaller than the full set) that match the numbers of overlapping SNPs for ancient individual pairs iden- tified as close relatives in this study: 125,110 for the pair Tepecik-Çiftlik 37-21; 86,247 for the pair Barcın M10_275-M10_271; 80,115 for the pair Barcın L11_216-L11_215; 22,076 for the pair Boncuklu ZHF-ZHJ; 20,810 for the pair As xıklı 131-136; 18,136 for the pair Boncuklu ZHBJ-ZHAF; 9,151 for the pair Çatalhöyük 2728-2842. Since, the pair As xıklı 128-133 share 741,193 SNPs, we used the full set of 157,172 SNPs for this Asxıklı pair (Figure S4B). Since simulating pedigrees starting from VCF files is significantly more straightforward than using BAM files, we performed NgsRelate with VCF files, which differs from the real situation where we had used BAM files. To account for genotype uncertainty while using VCF data we performed simulations using both diploid and pseudo-haploidized datasets. We then analyzed the distributions of q, k0, k1 and k2 estimates from NgsRelate from the simulated pedigrees. First, we used the 0.025 and 0.975 quantiles of these distributions (two tails of the distributions) to describe the range of expected values for each type of relationship given a certain SNP number, for first-, second-, and third- degrees as well as for parent-offspring, siblings, half-siblings and avuncular relationships. Differently, for the unrelated case we considered 0.95 as the upper limit (single tail of the distribution, considering zero as the lower edge). The mean value, standard deviation and estimated range for diploid and pseudo-haploidized data are summarized in Table Z16 (kinship coefficient for first-, second, and third- degrees and unrelated cases, number of samples n = 2,000) and Table Z17 (Cot- terman coefficients for parent-offspring, siblings, half-siblings and avuncular relationships, n = 700). The detailed first-degree relationships (e.g., mother-son, father-daughter, sisters) were studied through the q, k0, k1 and k2 estimates of the X chromosomes computed from two hundred pedigrees. The analysis was performed for the following X chromosomal SNP sets: (a) The full set of 179,716 SNPs, (b) 800 randomly chosen SNPs to inform on the lower limit, (c) Randomly chosen SNPs that match the numbers of overlapping SNPs for ancient individual pairs identified as close relatives in this study: 64,969 for the pair Asxıklı 128-133; 10,654 for the pair Barcın L11_216-L11_215; 9,940 for the pair Tepecik-Çiftlik 37-21; 6,558 for the pair Barcın M10_275-M10_271; 2,653 for the pair Asxıklı 131-136; 1,673 for the pair Boncuklu ZHBJ-ZHAF; 1,538 for the pair Boncuklu ZHF-ZHJ; 814 for the pair Çatalhöyük 2728-2842. From the resulting distributions, the 95% confidence intervals (ranges) of the coefficients were determined by considering the 0.025 and 0.975 quantiles. The mean value, standard deviation and estimated ranges resulting from the X chromosome simulation are summarized in Table Z18 (q coefficient, number of samples n = 200). In the attempt to better characterize mother-daughter and sisters relationships, we also computed the mean and variance of the ratio between autosomal (estimated using 5,000 SNPs) and X chromosomal (estimated using 800 SNPs) qs: qa 1 m = mðqa Þ 3 m qx qx and 2 2 qa 1 1 s2 = m qa 2 3 m mðqa Þ 3 m qx qx qx where m and s2 represent mean and variance, respectively, of autosomal q ðqa Þ or X chromosomal q ðqx Þ, calculated from the simu- lation outcomes. The resulting ratio coefficients are summarized in Table Z19. These values were then used to evaluate results shown in Figure 2B. We note that in Table Z16, the variance in theta estimates shows little dependence on SNP numbers (sample size). We hypothe- sized that this may be caused by the major contribution of variance in these estimates being the variance in background relatedness among pairs across different simulated pedigrees, rather than sampling error due to differences in randomly chosen SNP sets. In Current Biology 31, 1–14.e1–e18, June 7, 2021 e17 Please cite this article in press as: Yaka et al., Variable kinship patterns in Neolithic Anatolia revealed by ancient genomes, Current Biology (2021), https://doi.org/10.1016/j.cub.2021.03.050 ll Report order to test this idea, we measured the effect of SNP sample size on the variance of our estimates, within the same pedigrees only. Specifically, we generated 10 pedigrees and, for each pedigree, the subsampling process was repeated 10 times for a total of 100 simulations. The average values of the coefficients, together with the standard deviations, were computed for each subsampling and for all couples and relations of interest. Results are summarized in Tables Z20-Z23 for q, k0, k1 and k2, respectively. Spatial distances versus genetic distances among burials We studied the question of whether any distantly related pairs of individuals in this dataset, related beyond the 3rd degree, might tend to be buried in the same buildings or at closer proximity, compared to fully unrelated individuals. For this we applied two types of analysis described below. In both analyses we used the outgroup-f3 statistic between two individuals, calculated as f3(YRI, INDV1; INDV2), to measure genome-wide genetic similarity, and 1-f3 to measure genetic distance. Spatial-genetic distance correlations We selected specific subsets of individuals from As xıklı Höyük, Boncuklu Höyük, Çatalhöyük and Barcın Höyük. Table S4 presents the criteria used for selecting the subsets and the individuals excluded from each subset. Namely, in all sites, we included only individuals who were found not closely related, by removing one of each pair of close relatives identified in Figures 2A and 2B, keeping the in- dividual with the higher coverage. We created additional subsets removing individuals who were spatially or temporally distant from the rest (Table S4). In each subset, for the chosen individual pairs, we created matrices of spatial distance between each pair, calculated as the Euclidean distance between each pair of burials’ x and y positions in the site plan. For the same pairs of individuals, we also created genetic distance matrices, using (1-f3) as measure of distance, where the outgroup f3-statistic was calculated as f3(YRI, INDV1; INDV2), with YRI representing the outgroup, and INDV1 and INDV2 the genotypes of the individuals studied. We then calculated the Pearson correlation coefficient between each such pair of spatial and genetic distance matrices, and further calculated a one-sided Mantel test P-value using the ‘‘mantel.rtest’’ function in the R package ‘‘ade4’’ (v1.7-13).179 Average genetic similarity within buildings We tested whether individuals buried in or associated with the same building tend to show higher genetic similarity to each other, relative to individuals buried in or associated with other buildings. This test was performed on the Çatalhöyük and Barcın Höyük data, because these were the only sites with > 1 co-burial clusters. Again, we included only individuals who were found not to be closely related, by removing one of each pair of close relatives identified in Figures 2A and 2B, keeping the individual with the higher coverage. In Çatalhöyük the data included n = 9 such co-buried individuals associated with Buildings 17, 50, and 114. In Barcın Höyük the data included n = 8 such co-buried individuals associated with Buildings 4, 5, and 14/15. As a measure of genetic similarity, we used the outgroup f3, calculated as described above. We first calculated the within-building genetic similarity of all pairs of individuals from each of the 3 buildings, and calculated the mean of these distances. We then created a null distribution of mean co-burial genetic similarities, randomly assigning the 9 or 8 individuals to each building and calculating the mean of within-building similarities, 10,000 times (performed in R using the ‘‘sample’’ function). A one-sided P-value for the alternative hypothesis that within-building genetic similarity would be higher than random was calculated by comparing the observed value with the null. In both Çatalhöyük and Barcın Höyük, the mean similarity within buildings observed was within the randomly expected distribution. The permutation test P-values were calculated as 0.52 and 0.8, respectively. e18 Current Biology 31, 1–14.e1–e18, June 7, 2021